ID: 1108215971

View in Genome Browser
Species Human (GRCh38)
Location 13:48184866-48184888
Sequence TTCCTTCCCTTGAAGAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108215967_1108215971 9 Left 1108215967 13:48184834-48184856 CCTGGGATAATAAAATAAGTCCA No data
Right 1108215971 13:48184866-48184888 TTCCTTCCCTTGAAGAAAAGGGG No data
1108215966_1108215971 12 Left 1108215966 13:48184831-48184853 CCACCTGGGATAATAAAATAAGT No data
Right 1108215971 13:48184866-48184888 TTCCTTCCCTTGAAGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108215971 Original CRISPR TTCCTTCCCTTGAAGAAAAG GGG Intergenic
No off target data available for this crispr