ID: 1108221098

View in Genome Browser
Species Human (GRCh38)
Location 13:48233608-48233630
Sequence CCCGGCGCTCCCGTTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108221088_1108221098 28 Left 1108221088 13:48233557-48233579 CCGAGGTGGCGGGCGCGGGGCTC 0: 1
1: 1
2: 1
3: 20
4: 168
Right 1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 90
1108221087_1108221098 29 Left 1108221087 13:48233556-48233578 CCCGAGGTGGCGGGCGCGGGGCT 0: 1
1: 1
2: 1
3: 33
4: 255
Right 1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 90
1108221092_1108221098 2 Left 1108221092 13:48233583-48233605 CCGCGGGGACAAGTCCCCGAGAG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 90
1108221086_1108221098 30 Left 1108221086 13:48233555-48233577 CCCCGAGGTGGCGGGCGCGGGGC 0: 1
1: 1
2: 3
3: 38
4: 275
Right 1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108221098 Original CRISPR CCCGGCGCTCCCGTTTCCTG TGG Intronic
900241963 1:1621442-1621464 ACCGGGGCTTCCTTTTCCTGTGG - Intronic
901537367 1:9891284-9891306 CCCGGCCCTCCCATTGCCTGAGG + Intronic
901807678 1:11748567-11748589 CCCCGCGCTCCCGGTACATGTGG - Exonic
902169516 1:14598847-14598869 ACCGGCGCTGCCGGTGCCTGGGG + Exonic
902954152 1:19913389-19913411 CCCTTCGCTCTGGTTTCCTGTGG - Intergenic
904528948 1:31155396-31155418 CCCGCCGCCCCCGGCTCCTGAGG - Intergenic
913050632 1:115114110-115114132 CTCGGTCCTCCAGTTTCCTGGGG + Intergenic
913511992 1:119570498-119570520 CCCTGCCCTGGCGTTTCCTGTGG - Intergenic
913516215 1:119607661-119607683 CCCTGCCCTGGCGTTTCCTGTGG - Intergenic
916265843 1:162889002-162889024 CCCAGAGCTCCCCTTCCCTGAGG - Intergenic
922767936 1:228165765-228165787 CCCGCCCCTCCCGCTTCCTTGGG + Intergenic
923673841 1:236064252-236064274 CCCAGTGATCCCATTTCCTGTGG - Intronic
1066654597 10:37686486-37686508 CTTGGGGCTCCCGTCTCCTGGGG + Intergenic
1077196563 11:1283903-1283925 CCAGGCCCTCCAGCTTCCTGAGG - Intronic
1083920776 11:65780636-65780658 CCCCGCGCTCCCGGTGGCTGCGG - Exonic
1085333252 11:75669747-75669769 CCAGGCACTGCCGTTTCCTAGGG - Intergenic
1102197891 12:111037139-111037161 CCCGGCTCTCCGGCTGCCTGGGG - Intronic
1103749906 12:123151292-123151314 CCCGGCTCGCCCGTGTCCTCAGG + Intergenic
1103942059 12:124506549-124506571 CCCTGCACTCCAGGTTCCTGTGG + Intronic
1106833967 13:33614145-33614167 CCTGGTGCTCCAGCTTCCTGAGG + Intergenic
1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG + Intronic
1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG + Intronic
1121566697 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG + Intergenic
1123010479 14:105347301-105347323 TCCAGTGCTCCCGTTGCCTGGGG + Intronic
1124475043 15:30025857-30025879 CCAGGCGCTCCAGTTTCTTCCGG - Intergenic
1124883058 15:33659929-33659951 CCAGGCCCTGCCCTTTCCTGTGG + Intronic
1125506974 15:40272682-40272704 CCCTGCGCTGCTGCTTCCTGAGG - Exonic
1129540963 15:76346742-76346764 CCCGGCGCACGCGGTTCCTGGGG - Intergenic
1132475803 16:137420-137442 CGCGACGTTCCCTTTTCCTGTGG + Intronic
1132891187 16:2205612-2205634 CCCCGAGCTCCCCTTTCCTCCGG - Intronic
1136449165 16:30342997-30343019 CCCCACGCACCCGTTTCCCGTGG + Intergenic
1136598066 16:31265558-31265580 CCAGGCACTCCTGTGTCCTGGGG + Intronic
1142046260 16:87927065-87927087 CCCCACGCGCCCGTTTCCCGTGG - Intronic
1142549788 17:731962-731984 CCCGGACCTCACGCTTCCTGAGG + Intergenic
1142588097 17:987221-987243 CCCGGTGATCCCATTCCCTGGGG - Intergenic
1143007449 17:3846142-3846164 CCTGGGGCTCCCGTCCCCTGAGG - Exonic
1143958869 17:10697726-10697748 CCCGGCGCTCCGCTGTCCCGCGG - Intronic
1144704016 17:17355578-17355600 CCCGGCGCTCGGGGCTCCTGGGG + Intergenic
1145743258 17:27293980-27294002 CCCGGCGCGGGCGTTGCCTGGGG - Intergenic
1148633971 17:49133018-49133040 GCCAGCGCTCCCCATTCCTGGGG - Exonic
1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG + Exonic
1150488536 17:65560123-65560145 CCCGGCGCCGCCGTTTGCAGAGG + Intronic
1151760995 17:76103276-76103298 CCTGGCGGTTCCGGTTCCTGCGG - Intronic
1157286466 18:46380538-46380560 CCAGGCGCTTGCGTTTCCTCAGG + Intronic
1160710577 19:549262-549284 CCTGGCTCTCCCGTTCTCTGGGG + Intronic
1161777842 19:6273430-6273452 CCCGGCGCTGCGGATTCATGAGG + Intronic
1162017618 19:7853856-7853878 CCCGGGGCCCCTGGTTCCTGGGG + Intronic
1162496950 19:11028688-11028710 CCCTGAGCTCCCGTGTGCTGGGG - Intronic
1163451007 19:17377415-17377437 CCCGCAGCCCCCGTTTCCTCCGG - Intergenic
1165213895 19:34255191-34255213 CCCGGCCCTCCCGGTCCCCGCGG - Intronic
932682394 2:73836903-73836925 CCCGGGGCTCAGGATTCCTGAGG + Intronic
934758786 2:96842065-96842087 CCAGGGGCTCAGGTTTCCTGGGG + Exonic
935648631 2:105363254-105363276 CCCGGGGTTCCCATTTCCAGGGG - Intronic
939183009 2:138825956-138825978 CCCAGCACTGCCCTTTCCTGAGG - Intergenic
943639611 2:190343897-190343919 CCCGCCGCTTCCGTTTCTCGAGG + Exonic
948068136 2:235097440-235097462 CCCGGCACTGGCCTTTCCTGAGG - Intergenic
1168805366 20:669569-669591 CCCGGCGGCCCACTTTCCTGAGG + Intronic
1169206718 20:3744896-3744918 CTCCGCCCTCCCATTTCCTGCGG - Exonic
1169718664 20:8648131-8648153 CCCGGGGCTTCCCTTTCCTCTGG + Intronic
1179577436 21:42316901-42316923 CCAGGCGCTCCCATTTCTCGGGG - Intergenic
1182374650 22:29837916-29837938 CCCGGGGCTTCAGTTTCCTCAGG - Intronic
1182415892 22:30221260-30221282 CCAGGCACTTCTGTTTCCTGGGG - Intergenic
1182897755 22:33873123-33873145 CCCGGGCCTCCCTTTTGCTGGGG - Intronic
1183683812 22:39350334-39350356 CCCGGAGCCCTGGTTTCCTGGGG + Intronic
1183716498 22:39536189-39536211 CCCGGAGCTCCTGGCTCCTGTGG + Intergenic
1185317575 22:50185724-50185746 CCCGGCGCTCCCGGGTCCTAAGG - Intergenic
950546299 3:13640016-13640038 CACGGAGCTCCCGTGTCCTCAGG + Intergenic
952335805 3:32402002-32402024 CGCGGCTCTTCCTTTTCCTGGGG + Intronic
953876096 3:46667714-46667736 CCCGGGGCTCCATTTCCCTGGGG + Intergenic
955206436 3:56899931-56899953 CCAAGCACTCCCATTTCCTGTGG - Intronic
957041837 3:75341728-75341750 CCCACCGCCCCTGTTTCCTGGGG + Intergenic
961519177 3:127456888-127456910 CCCCGCCCACCCGCTTCCTGCGG - Intergenic
961674622 3:128557035-128557057 CCAGGAGCACCTGTTTCCTGAGG - Intergenic
968500428 4:947426-947448 CTTGTCTCTCCCGTTTCCTGAGG + Intronic
968674825 4:1871649-1871671 CCCGGCGCTCCCGCCCCCTCAGG - Intronic
969063269 4:4456522-4456544 CCTGGCCCTCCTGCTTCCTGTGG + Intronic
975180550 4:71339304-71339326 CCCGGAGCTCCACTTTCCTCAGG + Intronic
981475295 4:145180842-145180864 CCCGGCGCGCGCGATTCCCGCGG - Intergenic
997977102 5:138446881-138446903 CGCGGGGCTCCCGGTTCCTTGGG + Exonic
998152310 5:139764482-139764504 CCTGGCGCGCCCGCTCCCTGGGG + Intergenic
999272038 5:150302394-150302416 CCCGGCGCGCCGGGCTCCTGGGG + Exonic
1016949596 6:149566676-149566698 CACGCCGCCCCCATTTCCTGGGG - Intronic
1017174944 6:151494065-151494087 CCCGGCGCCGCCGCTTCCTCAGG + Exonic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1022698037 7:32728779-32728801 CCCCGCGCAGCTGTTTCCTGGGG + Intergenic
1023418073 7:39950550-39950572 GCCGCCGCTCCCGTTTCCGGCGG + Exonic
1032011566 7:128351176-128351198 CCCGGAGCTCCCCTCCCCTGGGG - Exonic
1032013336 7:128360666-128360688 CCCGCCCCTCCCGTTTCCTGGGG + Intronic
1032683577 7:134209492-134209514 CCCGGGGCTCCCCTGGCCTGGGG - Intronic
1034174535 7:149090542-149090564 CCGGGCTCGCCCGTGTCCTGGGG - Intronic
1047499505 8:125430718-125430740 CCCGGCGCTCGCGTTGCACGCGG - Exonic
1049782400 8:144434964-144434986 CCGGGGGCTCCCGGTGCCTGAGG + Intronic
1061590430 9:131594312-131594334 CCCGGAGCTTCCGATTCCTTAGG - Intronic
1062069768 9:134549403-134549425 CCCGGATCTCCCGCTTCCCGAGG - Intergenic
1198082550 X:133253033-133253055 CCCTGGCCTCCCCTTTCCTGTGG + Intergenic
1199601831 X:149545596-149545618 CCCGGGCCTCCCGTAGCCTGCGG - Exonic
1199648551 X:149933887-149933909 CCCGGGCCTCCCGTAGCCTGCGG + Exonic
1200047732 X:153411579-153411601 CCCCCCGCCCGCGTTTCCTGGGG + Intergenic