ID: 1108222971

View in Genome Browser
Species Human (GRCh38)
Location 13:48256606-48256628
Sequence CATGACTGTTCCTCCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108222966_1108222971 2 Left 1108222966 13:48256581-48256603 CCTTACCTACTCTTAAAGCCCAC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 154
1108222965_1108222971 7 Left 1108222965 13:48256576-48256598 CCTTGCCTTACCTACTCTTAAAG 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 154
1108222962_1108222971 13 Left 1108222962 13:48256570-48256592 CCTTCCCCTTGCCTTACCTACTC 0: 1
1: 0
2: 2
3: 70
4: 939
Right 1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 154
1108222967_1108222971 -3 Left 1108222967 13:48256586-48256608 CCTACTCTTAAAGCCCACCTCAT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 154
1108222963_1108222971 9 Left 1108222963 13:48256574-48256596 CCCCTTGCCTTACCTACTCTTAA 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 154
1108222964_1108222971 8 Left 1108222964 13:48256575-48256597 CCCTTGCCTTACCTACTCTTAAA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108222971 Original CRISPR CATGACTGTTCCTCCTTTGC TGG Intronic
900518974 1:3096549-3096571 CCTGCCTCTTCCTCTTTTGCCGG + Intronic
904807245 1:33140730-33140752 CACACCTGGTCCTCCTTTGCTGG - Intergenic
906780267 1:48567149-48567171 GATGATTGTTCCTCCTTCACAGG + Intronic
909523393 1:76595233-76595255 CATTATTGTTCCTCCTTTCAGGG + Intronic
914196534 1:145450790-145450812 CAGGACTCTGCCTCCTTTCCAGG - Intergenic
918608549 1:186459203-186459225 CAGGACCCTTCCTCCTTTTCAGG + Intronic
919435206 1:197550414-197550436 AATGAAAGTACCTCCTTTGCTGG + Intronic
920964976 1:210694016-210694038 TAAGACTTTTCCTCCTTTGAGGG - Intronic
922207628 1:223462103-223462125 CATGTCTGCCCCTCCTTTGTGGG + Intergenic
922247606 1:223816020-223816042 CATGACTGTATCTCCTTGACAGG + Intronic
923405971 1:233660776-233660798 CATCATTGTTCTTCTTTTGCAGG + Intronic
924795734 1:247291010-247291032 GATGATTGTGCCTCCTTTGCAGG + Intergenic
1063721678 10:8588658-8588680 CCTGCCTCTTTCTCCTTTGCCGG - Intergenic
1065041875 10:21705583-21705605 CATGAGTGTTCCCCATCTGCTGG - Intronic
1066637998 10:37526092-37526114 CATGACTGTACTTCCTTTTGCGG + Intergenic
1067160683 10:43822321-43822343 CCTGGCTCTTCCACCTTTGCTGG - Intergenic
1073330669 10:102668306-102668328 CCTGCCTGATCCTCCTTTGAGGG - Intergenic
1074293740 10:112162353-112162375 CATTACTGTGGCTCCTGTGCCGG - Intronic
1074632179 10:115271008-115271030 CAGGACTTTACCTCCTTTTCTGG - Intronic
1074892968 10:117750605-117750627 CATGACTGTACCTCCTTCCTAGG + Intergenic
1076728537 10:132425771-132425793 CGTGACCGTTCCTTCCTTGCAGG + Intergenic
1079458215 11:20655131-20655153 CCTAACTGATCCTCCTCTGCAGG - Exonic
1079865778 11:25731860-25731882 AATGACTGTTCTTCCTGTGTTGG - Intergenic
1084324268 11:68390560-68390582 GATGTCTGTTCTCCCTTTGCTGG + Intronic
1084489534 11:69471017-69471039 CATGACTAGTCCTGCTTTTCGGG + Intergenic
1085189776 11:74609154-74609176 GATGACTGTGCATCCTTAGCAGG - Intronic
1087561479 11:99796256-99796278 CCTGACTGTGCCACCATTGCTGG - Intronic
1090226433 11:125074779-125074801 TATGACTGTTCTTTCATTGCAGG - Intronic
1090773711 11:129945012-129945034 CAAGACTGTCTCTCTTTTGCAGG - Exonic
1091708158 12:2714594-2714616 CATGACTAGCCTTCCTTTGCTGG + Intergenic
1094430122 12:30359336-30359358 CATGACTAGCCTTCCTTTGCTGG + Intergenic
1094587896 12:31794700-31794722 CCTAACTGTTCCTCCTGTCCAGG + Intergenic
1095361608 12:41347963-41347985 CATGTCTGTTCCTCCTTATTAGG - Intronic
1095543071 12:43333406-43333428 CATGACAGTTGATACTTTGCAGG - Intergenic
1095842003 12:46703508-46703530 CATGTCTGTTCCACCATTGCTGG + Intergenic
1097174870 12:57136664-57136686 GGTGACTGTTCCTCCTGTGGAGG + Intronic
1100167395 12:91931511-91931533 CATGACTTTTCTTCCCTTTCTGG - Intergenic
1100603756 12:96134030-96134052 CATGCCTGCTGCTCCCTTGCTGG - Intergenic
1100922030 12:99499058-99499080 CATAACTGTTACTTCTTTTCTGG - Intronic
1102208560 12:111107323-111107345 CATGTAAGTTTCTCCTTTGCAGG + Intronic
1103266797 12:119637370-119637392 CATGACTGTGTCTCATTAGCAGG + Intronic
1104374118 12:128249104-128249126 CATGACTGCCCCTCCCTTGCAGG - Intergenic
1107200091 13:37704671-37704693 CAAGTCTGTTCCTATTTTGCTGG + Intronic
1107527863 13:41251183-41251205 TATGCCTATTCATCCTTTGCAGG + Intronic
1107936814 13:45352209-45352231 CATGACTGCTCCACCTTCCCTGG - Intergenic
1108222971 13:48256606-48256628 CATGACTGTTCCTCCTTTGCTGG + Intronic
1113617517 13:111691411-111691433 CAGGAATGTCCCGCCTTTGCCGG - Intergenic
1113623047 13:111776671-111776693 CAGGAATGTCCCGCCTTTGCCGG - Intergenic
1119589997 14:75877539-75877561 CATGACTCTTGTTTCTTTGCTGG - Intronic
1126426938 15:48537841-48537863 CATGATGGTTCCTGCTTTTCTGG - Intronic
1129525769 15:76213269-76213291 CAGGACTTTTCCTGATTTGCAGG - Intronic
1133862960 16:9613666-9613688 TATGACTGTTCCTCCTTATCTGG - Intergenic
1138149589 16:54643899-54643921 CATGACAGTTCCTACTTCTCAGG - Intergenic
1141333820 16:83136629-83136651 CATAGCTGTTCCTTCTCTGCCGG + Intronic
1141564954 16:84895136-84895158 AATGACGGTTCCTACTTTGCAGG - Intronic
1141640764 16:85339705-85339727 AATGACTCTTAATCCTTTGCTGG + Intergenic
1142052683 16:87969398-87969420 CATGGCTGTTGCGCTTTTGCTGG - Intronic
1147784468 17:42969226-42969248 CACAAATGTTCCTGCTTTGCAGG - Intronic
1150504883 17:65688619-65688641 CATGACTCTCCCTCCGGTGCTGG - Intronic
1153100598 18:1464660-1464682 CATGACTGTTCTTCCTGTTTGGG + Intergenic
1157583333 18:48786060-48786082 CATCATTCTTCCTCCTTTGCAGG + Intronic
1158156631 18:54432987-54433009 CAGCACTGCTGCTCCTTTGCGGG + Intergenic
1158301675 18:56059632-56059654 CATGACTATTCCTTTTTTCCAGG - Intergenic
1159015335 18:63097865-63097887 CATTAATGTTTCTCCTTTCCAGG + Intergenic
1161236857 19:3202457-3202479 CATGACTGTGTCTCCTGTGCGGG + Intronic
1161776142 19:6263290-6263312 CATGCCCGTGCCTCCTCTGCTGG - Intronic
1167313114 19:48748805-48748827 AATGAATGTTCCACCATTGCTGG - Exonic
1168457010 19:56520316-56520338 CATGGTTGTTCCTCATTTCCTGG - Intronic
1168665522 19:58202082-58202104 CATCACTTTTCCTCCTTGTCTGG - Intronic
927315383 2:21675435-21675457 CATGACTGCTCCTTCGTTTCCGG + Intergenic
927677959 2:25120723-25120745 CATGACTGTTGCTTCTCTGCAGG + Intronic
931155343 2:59622263-59622285 CTTGATTGGTCCTCCCTTGCAGG + Intergenic
931175258 2:59848028-59848050 CATGGTTGTTCCTCCATTCCAGG + Intergenic
931410862 2:62030001-62030023 CATGGCTGTCCATACTTTGCTGG - Intronic
933559414 2:83873245-83873267 CATTACTGTTCCCCCTTTCAGGG + Intergenic
933674641 2:85043884-85043906 CATTACTTTTCCTCTTTTGGGGG - Intronic
936286188 2:111183119-111183141 ACTGGCTGGTCCTCCTTTGCAGG + Intergenic
936441330 2:112556183-112556205 CATCACTGCTCCACCTCTGCTGG - Intronic
940201630 2:151157786-151157808 CATGGCTGTTCCTCCTTGGTTGG + Intergenic
947164390 2:227247093-227247115 CAGGGCTGCTCCTCCTTTACAGG - Intronic
947879106 2:233489459-233489481 CATGACCTTGCCTCCTTTCCTGG - Exonic
1168789968 20:569282-569304 CATGCCAGTATCTCCTTTGCAGG - Intergenic
1171467169 20:25337669-25337691 CATGGCTTTTCTACCTTTGCTGG - Intronic
1172347769 20:34217479-34217501 CAGGACCCTTCCTCCTTTTCAGG + Intronic
1172551993 20:35808447-35808469 CATGCCTATTCCTTGTTTGCTGG + Intronic
1175153476 20:56953578-56953600 CCTGGCTGTCCCTGCTTTGCTGG - Intergenic
1176421591 21:6520343-6520365 CAGGTCTGTTCAACCTTTGCAGG - Intergenic
1176728406 21:10464608-10464630 CTTAACCCTTCCTCCTTTGCAGG + Intergenic
1179697081 21:43128659-43128681 CAGGTCTGTTCAACCTTTGCAGG - Intergenic
1184594938 22:45508108-45508130 AATGACAGCACCTCCTTTGCAGG - Intronic
949519199 3:4834279-4834301 CAAAACTGTTTCTCCTTTGAGGG + Intronic
953294993 3:41706104-41706126 CATGCTAGTGCCTCCTTTGCCGG + Intronic
954268477 3:49488870-49488892 CAAAACTGTTCCTTTTTTGCCGG - Intronic
954463070 3:50638644-50638666 CTTGGCTGTCCCTCCTTTTCTGG - Intronic
955492942 3:59501397-59501419 CCTGACTTCTCCACCTTTGCCGG - Intergenic
955781443 3:62489129-62489151 CATGACTGCTACTTCTTTGGGGG - Intronic
956038209 3:65118427-65118449 CATTAATCTTCCACCTTTGCCGG + Intergenic
958596637 3:96234095-96234117 CTTGACAGTTCCTCCTTTACAGG + Intergenic
958996094 3:100907146-100907168 TATGATTTTTCCTACTTTGCAGG - Intronic
960095988 3:113690474-113690496 CATGACTGTACCTTCTTCACTGG + Intronic
963748757 3:149152506-149152528 CCTCACGGTTCCTCCTTTCCTGG + Intronic
966899695 3:184471638-184471660 CATGACTCTTGTTCCTTTGTAGG + Intronic
970979764 4:22082635-22082657 CATGGCCTCTCCTCCTTTGCTGG - Intergenic
971226156 4:24753132-24753154 AATCACAGTTCCTCCTTTGCAGG - Intergenic
971489794 4:27199351-27199373 CCTGACAGTTACTCCTTTGGAGG + Intergenic
974003948 4:56537172-56537194 CCTGACTGTTTCTCCTTCTCAGG + Intronic
975470580 4:74761292-74761314 CATGGCTCATTCTCCTTTGCAGG + Intronic
977899030 4:102397168-102397190 CCTAAGTCTTCCTCCTTTGCTGG + Intronic
978907068 4:114018195-114018217 GGTGAATGATCCTCCTTTGCTGG - Intergenic
981851408 4:149234415-149234437 AATGACTTTACGTCCTTTGCAGG - Intergenic
985732624 5:1557732-1557754 CATGACTGCTCCTGCTTGGGAGG - Intergenic
988940547 5:36140521-36140543 CATGACTCTTCCATCTTTGGAGG + Intronic
990253069 5:53936950-53936972 AGAAACTGTTCCTCCTTTGCAGG + Intronic
991020602 5:61976343-61976365 CAGGTCTCTTCCTCCTTTGCTGG - Intergenic
991652865 5:68873974-68873996 CTTACCTGTTTCTCCTTTGCAGG + Intergenic
993234366 5:85284653-85284675 CAAAACTGTTTCTCATTTGCAGG - Intergenic
995840204 5:116436727-116436749 CATGACTGCTCCTGCAGTGCAGG - Intergenic
999095302 5:148972761-148972783 CCAGAATGTGCCTCCTTTGCAGG - Intronic
1000157866 5:158569515-158569537 CATGAGTGTGCGACCTTTGCAGG - Intergenic
1000376751 5:160589696-160589718 CCTGTCTGTTCCTCCTCTGCAGG - Exonic
1000395952 5:160774938-160774960 CATGATTTTTCCCCATTTGCTGG - Intronic
1003322032 6:5060367-5060389 CATTACTGTTTATGCTTTGCAGG + Intergenic
1003388913 6:5695404-5695426 CATGTCTGTGACTCATTTGCTGG + Intronic
1003958971 6:11191627-11191649 GATTACTGTGCCTCCTGTGCAGG + Intronic
1005131114 6:22509080-22509102 GATAACTGATCCTGCTTTGCCGG + Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006601821 6:35231388-35231410 CATCACTGTTCCTCTTTCTCTGG + Intronic
1006967590 6:38004358-38004380 CGTCAGTGTTCCTCCTCTGCAGG + Intronic
1007122298 6:39393042-39393064 CATCTAAGTTCCTCCTTTGCAGG - Intronic
1013267252 6:108512114-108512136 CATGCCTGGTACTCATTTGCTGG - Intronic
1013615369 6:111838071-111838093 AAAGACTGATCCTCCTTTGTGGG - Intronic
1015808837 6:137141291-137141313 CATGATTGTTTCTACTTTACAGG - Intergenic
1015963242 6:138671592-138671614 GATGAGTGTTCCTCCGTGGCTGG - Intronic
1016602529 6:145878658-145878680 CATGGGTTTTCCTCCTTGGCAGG - Intronic
1019802966 7:3101942-3101964 CACGCCTGTTCCTCCTTTGCCGG - Intergenic
1020329500 7:7003258-7003280 CTTGGGTTTTCCTCCTTTGCTGG - Intergenic
1022725366 7:32976456-32976478 CATCACCATTCCTCCTTTTCTGG + Exonic
1023097105 7:36672450-36672472 GATGAGTGCTCGTCCTTTGCAGG + Intronic
1023748343 7:43344449-43344471 TATGACTCTTGCTCCTTTGAAGG + Intronic
1023852031 7:44155824-44155846 CTTGAGTGATCCTCCCTTGCAGG + Intronic
1025048246 7:55711384-55711406 CATCACCATTCCTCCTTTTCTGG - Intergenic
1026108102 7:67437020-67437042 CATGACTGTTTCTGCTGTGTTGG - Intergenic
1028189714 7:87832015-87832037 CATGACTTTTCCTCCTTTCTTGG + Exonic
1031823693 7:126535484-126535506 CATGACTGTTCCTGCAGAGCAGG + Intronic
1034015570 7:147581378-147581400 CATGAATGTTTCTCCTATGAAGG - Intronic
1034601683 7:152263362-152263384 CTTAACCCTTCCTCCTTTGCAGG - Intronic
1037507580 8:19547193-19547215 AAAGTCTGCTCCTCCTTTGCTGG + Intronic
1038192705 8:25338547-25338569 AATGACTGTCCCTCCTTTCCAGG + Intronic
1039626278 8:39058066-39058088 CATCACTTTACCTCCTTTTCTGG - Intronic
1039756130 8:40524983-40525005 CATGTCTTTTCCTTCTGTGCTGG + Intergenic
1040356246 8:46621277-46621299 CTTGGGTTTTCCTCCTTTGCTGG - Intergenic
1043197687 8:77319305-77319327 CATGATTATTGCTCATTTGCAGG - Intergenic
1047233683 8:123019727-123019749 AATGCCTGTTCCCCCTTTCCTGG + Intronic
1048471636 8:134709350-134709372 CAGGACTGTGTCTCCTTTGCCGG + Intronic
1049589981 8:143453898-143453920 CATGACTGATCCACGTCTGCTGG - Intronic
1050622914 9:7473521-7473543 CTTTACTGTGGCTCCTTTGCTGG + Intergenic
1052847140 9:33346814-33346836 CATGTCTCTTCCTCCTTGGTTGG + Intronic
1059044961 9:110856363-110856385 CCTGACTGTTACTCCTTCACAGG + Intergenic
1060931380 9:127491569-127491591 CATCACTGTGTCTCCTGTGCTGG + Intronic
1062698198 9:137886044-137886066 CAGGACTCTGCCTCCTTTCCAGG + Intronic
1187203081 X:17154718-17154740 CATCACTTTTCTTCATTTGCTGG + Intergenic
1189067402 X:37825032-37825054 CAAGACTCATTCTCCTTTGCTGG - Intronic
1190296377 X:49030102-49030124 CCTGACTGGTCCTCCTTTCCTGG + Exonic
1191851266 X:65588024-65588046 CATGCCCCTTCCTCCTCTGCAGG + Intergenic
1194906830 X:99587598-99587620 CATCACTGTACATCCTTTACAGG + Intergenic
1195071099 X:101280721-101280743 CATAACTGTTCTCCCTTTGAAGG - Intronic
1195213452 X:102672755-102672777 CATGCTTTTTCCCCCTTTGCTGG - Intergenic
1197488006 X:127078013-127078035 CCTCAATGTTCTTCCTTTGCAGG - Intergenic
1198986092 X:142455924-142455946 GATAACTGTTTCTGCTTTGCTGG - Intergenic
1199095643 X:143735510-143735532 CATGAGTGACCCTCCTTTGAAGG - Intergenic
1199373312 X:147077200-147077222 CATCATTGTTCCTGCTTTTCAGG + Intergenic
1199987040 X:152959986-152960008 CATGCCTGTTTATCCTCTGCAGG + Intronic
1200878666 Y:8188074-8188096 CATGAGTTTATCTCCTTTGCAGG - Intergenic