ID: 1108223499

View in Genome Browser
Species Human (GRCh38)
Location 13:48263423-48263445
Sequence CATGCTGGAAACTGTGGTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108223492_1108223499 -5 Left 1108223492 13:48263405-48263427 CCCTTTGAACCCTTGTGCCATGC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG 0: 1
1: 0
2: 4
3: 25
4: 195
1108223493_1108223499 -6 Left 1108223493 13:48263406-48263428 CCTTTGAACCCTTGTGCCATGCT 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG 0: 1
1: 0
2: 4
3: 25
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108223499 Original CRISPR CATGCTGGAAACTGTGGTCT TGG Exonic
900390082 1:2430022-2430044 CATGGAGGAAGCTGTGGCCTCGG + Intronic
902923063 1:19678854-19678876 CATGCTGGGAAGGGTGGCCTGGG + Intronic
903486691 1:23694696-23694718 GATACTGGAAACTTTGGTTTTGG + Exonic
904878109 1:33672032-33672054 CATGCTGGGAGCTGTAGACTGGG - Intronic
906979363 1:50612652-50612674 CATGCTAACAACTTTGGTCTCGG + Intronic
907214934 1:52854774-52854796 CATGATGGAAATTGTCTTCTAGG + Intronic
909988468 1:82191812-82191834 CCTGCTGGAAACTATGTTCATGG + Intergenic
910326784 1:86018231-86018253 CATATTGGAAACTGTGCTTTAGG - Intronic
911309770 1:96278017-96278039 CAAGCTGGAAACTGGGGACTTGG + Intergenic
911478712 1:98408843-98408865 CATGCTAGAAACTCAGGGCTTGG - Intergenic
912426638 1:109598870-109598892 CCTTCTGGAATCTGTGCTCTGGG + Exonic
915140308 1:153763856-153763878 CATGCAGGAAATTGTGGACCAGG + Exonic
915470034 1:156120400-156120422 CAGCCTGGAAACTCTGCTCTGGG + Intronic
916447852 1:164890416-164890438 CATACTGAAAAGTGTGCTCTGGG - Intronic
917908977 1:179620699-179620721 AATGCTTGAAACTGTGCTATAGG + Intronic
920191087 1:204194343-204194365 AATGCAGAAAGCTGTGGTCTGGG - Intronic
920453097 1:206075189-206075211 CTTGCTGGAAAGTATGGTGTTGG + Intronic
920846922 1:209601512-209601534 CATGCTGGAGACACAGGTCTAGG + Intronic
922183792 1:223256787-223256809 CCTGCTGGAAATTTTGATCTGGG - Intronic
923778411 1:236999927-236999949 GATTCTGTAGACTGTGGTCTGGG + Intergenic
1066201852 10:33149643-33149665 CATCATGGAACCTGTGGTCATGG + Intergenic
1066962788 10:42236207-42236229 CTGGCTGGGAACTGGGGTCTGGG + Intergenic
1067273530 10:44813809-44813831 CATGCTGGAATATGTTGTCCTGG + Intergenic
1067450813 10:46380889-46380911 CAAGATGGAATCTGAGGTCTGGG - Intronic
1067526186 10:47040151-47040173 GAGGCTGGAACCTGTGGGCTGGG - Intergenic
1067557488 10:47282924-47282946 CATGCTGGAAATGGAGGTGTGGG + Intergenic
1067586430 10:47478862-47478884 CAAGATGGAATCTGAGGTCTGGG + Intronic
1068475225 10:57515917-57515939 CCTACTGTAAACTATGGTCTTGG + Intergenic
1070638105 10:78145465-78145487 CATGCTGGAGACAGTCCTCTGGG + Intergenic
1071701693 10:87945798-87945820 GATACTGGAAACTTTGGTTTTGG + Intronic
1073546033 10:104349763-104349785 AATGCTGGAAAAGGTAGTCTGGG + Intergenic
1077782279 11:5343961-5343983 CATGCAGGAAAATGTGGATTAGG - Intronic
1080675244 11:34420464-34420486 CATGCTCAAAACTGTGTTTTAGG - Intergenic
1083409405 11:62481522-62481544 CTTGCTAGAAGCTGAGGTCTAGG - Intronic
1084701737 11:70790783-70790805 GATGCTGGGACCTGTGGTCCCGG - Intronic
1088309037 11:108440883-108440905 CATGCTGGGAGCTGTAGACTGGG - Intronic
1089640591 11:119844954-119844976 CTTGCTGGAAACTTGGGTCTCGG - Intergenic
1089820571 11:121222231-121222253 CATGCAGGTAAATGTGGTCTTGG + Intergenic
1090079486 11:123602269-123602291 CATACCTGAAACTGTGGGCTTGG + Intronic
1094323630 12:29212602-29212624 GATGGTGGAAACTCAGGTCTGGG - Intronic
1098072798 12:66694189-66694211 CATGCTGGAAACTGTTCTGCAGG - Intronic
1098773657 12:74586238-74586260 CATTCAGGATACTTTGGTCTTGG - Intergenic
1099354427 12:81616030-81616052 CATGCTGGTAATTGTGGTGATGG + Intronic
1100420622 12:94429555-94429577 CATGGTGGTAGCTGTGGGCTGGG - Intronic
1102023086 12:109697325-109697347 CATGTTGGAAGCTGCGGCCTGGG + Intergenic
1102055322 12:109892447-109892469 CAGGCTGGACACAGTGGTATGGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102877614 12:116459980-116460002 CATGCTATAAACTGTGCTTTTGG + Intergenic
1103848781 12:123917753-123917775 CATGCTGGACAATGTGGACCTGG + Exonic
1106563104 13:30863435-30863457 CATGCTGGAAGGTGTGGGCAAGG - Intergenic
1106788782 13:33133226-33133248 CAAGCTGGGCACTGTGGCCTGGG + Intronic
1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG + Exonic
1108705063 13:52977831-52977853 GATGCTGGAAGCACTGGTCTTGG + Intergenic
1109390694 13:61687936-61687958 CATCAAGGAAACTGTGGACTTGG + Intergenic
1110972978 13:81790062-81790084 GATGCTGGAAAATGTGGACTGGG + Intergenic
1112308020 13:98292856-98292878 CCTGCTGGTAACTCTGGTCTAGG + Intronic
1113413223 13:110108208-110108230 CAGGCTGGAACCTGTGGTCTCGG + Intergenic
1115091388 14:29580966-29580988 CATGATGTCATCTGTGGTCTGGG - Intronic
1118001076 14:61524429-61524451 CAAGCCGGTAACTGTGGTTTTGG + Intronic
1120200630 14:81534121-81534143 CATTCTGGGAATTGTAGTCTCGG - Intergenic
1120441208 14:84542818-84542840 GATGCTGATAACTGCGGTCTGGG + Intergenic
1120925548 14:89793816-89793838 CTAGCTGCAAACTGTAGTCTAGG - Intergenic
1121085968 14:91146368-91146390 CATGCTGGAAATTGTGCTCAGGG - Intronic
1121794123 14:96721567-96721589 CATGATGGAATCTGGGGTCAAGG - Intergenic
1122454537 14:101839815-101839837 CATGCTGGACACGGGGGTGTGGG + Intronic
1123069388 14:105634807-105634829 CATGGTAGAAACTGAGGTCTTGG - Intergenic
1123088487 14:105730596-105730618 CATGGTAGAAACTGAGGTCTTGG - Intergenic
1123094434 14:105759968-105759990 CATGGTAGAAACTGAGGTCTTGG - Intergenic
1124217412 15:27818958-27818980 CATGCTGCCTACTGTGGCCTGGG + Intronic
1125197966 15:37070385-37070407 CACTCTGGAAAATGTGGTCCGGG - Intronic
1127801032 15:62477745-62477767 CATACTGGAAGCTGGGGACTGGG + Intronic
1129161136 15:73748628-73748650 CTCTCTGGAACCTGTGGTCTTGG - Intronic
1130091453 15:80824489-80824511 GATGCTGGAGACTGTCCTCTTGG - Intronic
1130211424 15:81926444-81926466 AATGCTGAAAACTGTGGTCTGGG - Intergenic
1131823977 15:96302055-96302077 CATTCTGAAAACAGTGGTCTAGG - Intergenic
1132475718 16:136781-136803 TATGATGGAAACTGAGGGCTGGG + Intronic
1133550787 16:6852844-6852866 CATGCTGGGAACTGCTGTCCAGG + Intronic
1133671895 16:8030944-8030966 TCTGGTGGAAGCTGTGGTCTTGG + Intergenic
1136862023 16:33710250-33710272 CTGGCTGGGAACTGGGGTCTGGG - Intergenic
1140357821 16:74321021-74321043 CAGGCTGGAAACTGGGGTCTTGG + Intergenic
1141222673 16:82085793-82085815 CAAGCTTGAAAATGTGGTCCGGG - Intronic
1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG + Intronic
1143544174 17:7586823-7586845 CCTGCTGGGAACTCAGGTCTGGG + Intronic
1143715600 17:8766231-8766253 CAAGCTGGAAACACTGGTATAGG - Intergenic
1147646174 17:42035458-42035480 CATGCAGGGACCTGTGGGCTGGG + Intronic
1148244411 17:46021145-46021167 GATGCTGCGAACTGTGGCCTGGG + Intronic
1150075270 17:62186775-62186797 CCTGCTGGAATCTATGATCTAGG + Intergenic
1153413384 18:4818777-4818799 CATGCAGGAAACTGTCATCATGG - Intergenic
1154991166 18:21600000-21600022 CATGCTGCAAATGGGGGTCTCGG - Intronic
1155684006 18:28524591-28524613 CATGCTGGAAACAGTGATCCAGG - Intergenic
1157171394 18:45409651-45409673 CATCCTGTAAACTGTCTTCTGGG - Intronic
1157201544 18:45664047-45664069 CATTCGGGGAACTGTGGCCTTGG - Intronic
1161894833 19:7072581-7072603 CATGCTCCAAACTGTGAACTTGG + Intronic
1162454803 19:10776959-10776981 CATGTCGGAAACTGGGGTCCAGG + Intronic
1165520687 19:36311739-36311761 GATTCTGGAAAATGTGGTCCCGG + Intergenic
1165623384 19:37266845-37266867 GATTCTGGAAAATGTGGTCCCGG - Intergenic
1166621478 19:44305095-44305117 CATTCTGGGAACTGTAGTCCAGG - Intergenic
925541706 2:4974394-4974416 CATGCTGCACACTGGGGTGTTGG + Intergenic
926136615 2:10341152-10341174 TATGATAGAAACTGTGGGCTGGG + Intronic
926505941 2:13716108-13716130 GAATCTGCAAACTGTGGTCTGGG - Intergenic
926792539 2:16589105-16589127 GATGCTGGGCACTGTGTTCTTGG + Intronic
927128330 2:20034210-20034232 CATGCTGTAACCTATGGTTTGGG - Intronic
929432313 2:41897638-41897660 CATGCTGTCAGCTGTGGGCTTGG - Intergenic
929795668 2:45056685-45056707 AATGTTGAAAAATGTGGTCTTGG - Intergenic
930722870 2:54654564-54654586 CATGCTGGTCACTGCTGTCTAGG + Intronic
931578873 2:63751939-63751961 CATGATGGCAGCTGTGGTCATGG - Intronic
932280945 2:70491384-70491406 CAAGCTGAAAACTTTGGTTTGGG - Intronic
934732119 2:96666004-96666026 CACCCTGGAGACTGTGTTCTGGG - Intergenic
936480348 2:112879807-112879829 CCTGCCGGCACCTGTGGTCTGGG - Intergenic
936997242 2:118428341-118428363 GCTGCTGGAAACTGGGGACTGGG - Intergenic
937373548 2:121319546-121319568 CAGGCTGGAGACTGAGCTCTGGG - Intergenic
938055908 2:128214503-128214525 CCTGGTGGAACCTGTGTTCTGGG + Intergenic
938668697 2:133566148-133566170 AATACTGGAAACTGAGGTCCAGG + Intronic
939772332 2:146336602-146336624 CATGATGGAAACTCTATTCTAGG - Intergenic
941578402 2:167265097-167265119 TCTGCTGGGAACTGTGTTCTAGG + Intergenic
946016780 2:216610428-216610450 CATGCTGAATGCTGTGGACTGGG - Intergenic
946290676 2:218742559-218742581 CATGCTAGAAACTATGACCTTGG - Intronic
947316371 2:228863683-228863705 AATGCTAGATTCTGTGGTCTTGG + Intronic
947760487 2:232600308-232600330 CATCCTGGCAGCTGCGGTCTGGG - Intergenic
948188973 2:236044039-236044061 CACTCTGGAAACAGTGCTCTGGG - Intronic
1169611855 20:7389941-7389963 CATGCTGGAATCTGTGATCTAGG - Intergenic
1170330243 20:15201556-15201578 CATGTAACAAACTGTGGTCTTGG - Intronic
1170539760 20:17375861-17375883 CATGGCAGAAGCTGTGGTCTAGG - Intronic
1172160378 20:32863887-32863909 CATGCTGGTAAGTGAGGTTTTGG - Intronic
1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG + Intronic
1172935945 20:38620325-38620347 CATGCTGCAAAATGTGATGTTGG + Intronic
1175768681 20:61608880-61608902 CATGCTGGCAGCTGGGGCCTTGG + Intronic
1176946650 21:14990344-14990366 TATGCTGGGAACTGTGTACTAGG + Intronic
1177266011 21:18784970-18784992 CATGTTGGAAAATGTGATATTGG - Intergenic
1179828159 21:43979872-43979894 CCTGCTGGAAACTGGGGTTGGGG - Intronic
1182635953 22:31727185-31727207 CATGGTCGAAACAGTGGGCTTGG - Intronic
1182866423 22:33608122-33608144 CATTATGGCAACTGTGGCCTTGG - Intronic
1184916082 22:47569932-47569954 CATGATGGAAACACTGGCCTTGG + Intergenic
1185263606 22:49885492-49885514 CGTGCTGAAAACTGAGGTCTCGG + Exonic
950084905 3:10250121-10250143 CATGCTGGAAACTATGACTTTGG - Intronic
950584539 3:13882914-13882936 CATGAGTGAAACTTTGGTCTAGG - Intergenic
951522267 3:23620963-23620985 CATGCTGGGAACTGGGGTAGGGG + Intergenic
951780936 3:26362302-26362324 CACGCTGGAAGCTGTAGACTGGG - Intergenic
953004954 3:38969547-38969569 CATCCTTGACCCTGTGGTCTAGG + Intergenic
953116110 3:39994087-39994109 CACGCTGGAAGCTGTAGACTGGG - Intronic
955407665 3:58635731-58635753 TAAGCTAGAAAATGTGGTCTTGG - Intronic
958038086 3:88193345-88193367 AATTCTGGAAACTGTGCTGTCGG + Intergenic
958150005 3:89679522-89679544 CATGTAAGAAACTGTGGTTTAGG + Intergenic
960817925 3:121692433-121692455 CATTCTGAGAACTGTGGTATAGG + Exonic
965290890 3:166878266-166878288 GATGCTGGAAAATGTAGTTTTGG + Intergenic
965604085 3:170482542-170482564 CATGCTGGAAACAAAGGGCTGGG + Intronic
965631777 3:170740634-170740656 CATTCTGAAAACTGGGGTTTAGG + Intronic
966485028 3:180458964-180458986 CACGCTTGAAACTTTGGACTGGG - Intergenic
968149689 3:196327404-196327426 CATGCTGGGAACTGGGCTCTGGG - Exonic
968285179 3:197504474-197504496 CTTGCTGGCAACTGTGTTCTGGG - Intergenic
968739958 4:2322441-2322463 CAGGCTGGATCCTGGGGTCTCGG + Intronic
969187412 4:5486676-5486698 CATGCTGGGAGCTGTAGACTGGG + Intronic
969286548 4:6205983-6206005 CATCCTGGAAACTGTGATATGGG - Intergenic
969484824 4:7466427-7466449 GAGGCTGGGAAATGTGGTCTTGG + Intronic
974297300 4:60018159-60018181 GAGGCTGGAAAATGTGCTCTTGG + Intergenic
975086872 4:70352216-70352238 CCTGCTGGGAGCTGTGGTGTTGG - Intergenic
978207371 4:106093885-106093907 CCTGATGTAAACTGTGGACTTGG + Intronic
979412874 4:120400647-120400669 CAAGCTGGGAACTGTGGTATAGG + Intergenic
979890570 4:126087684-126087706 CCTGATGGGAACTGTGGTCATGG + Intergenic
980603447 4:135057962-135057984 GATTCCTGAAACTGTGGTCTTGG - Intergenic
985578367 5:684139-684161 CAAGGTGGAAACTGTGGCCGTGG - Intronic
989521279 5:42403535-42403557 CCTGCAAGAAACTGTGGCCTTGG + Intergenic
989770203 5:45135776-45135798 CTTGCTGTAAACTTTGGTGTGGG - Intergenic
991638492 5:68730597-68730619 CATGTGGGAAATTGTTGTCTGGG - Intergenic
991661598 5:68956402-68956424 CATCTTGGAAACTGCTGTCTTGG - Intergenic
992989772 5:82272767-82272789 ATTGCTGGATACTGTGGTTTTGG - Intronic
996648810 5:125848474-125848496 CATGATGTGAACTGTGATCTTGG - Intergenic
997190634 5:131931568-131931590 GAAGCTGAAAACTGTGGTATGGG + Intronic
997459460 5:134042231-134042253 CATCCTGGGCACTGTGGGCTTGG + Intergenic
997662481 5:135600111-135600133 CATGCTGGGAACTGTGTCTTTGG + Intergenic
997796607 5:136817141-136817163 CCTGATGGAAACTGTAGCCTGGG + Intergenic
998039737 5:138944648-138944670 CATCCTGGGAACTGTGGTCAAGG - Intergenic
998845318 5:146303068-146303090 CATGCTGGAGACTGGGGATTAGG - Intronic
999685037 5:154095051-154095073 CCTGCTGTAAACTATGGACTGGG + Intronic
1000814690 5:165906139-165906161 CATGATGGAAACAGTGGACATGG + Intergenic
1001261654 5:170234045-170234067 CATCCTGGAGAATGGGGTCTTGG + Exonic
1002315263 5:178339270-178339292 AATTCTGGAAACTGTGGTCGTGG - Intronic
1002762961 6:216013-216035 CTACCTAGAAACTGTGGTCTCGG - Intergenic
1002873008 6:1184507-1184529 AATGCTAGAAAATGTGGACTTGG + Intergenic
1003055838 6:2819396-2819418 AATACTGGAAACTGTGCTCGTGG - Intergenic
1003454021 6:6263929-6263951 CAATTTGGAAGCTGTGGTCTAGG - Intronic
1005064923 6:21808423-21808445 CATGCTGTAAACTTTGGTAGTGG + Intergenic
1006651313 6:35554116-35554138 CATGATTAAAACTATGGTCTTGG + Intergenic
1007438257 6:41833832-41833854 CATGCTGAATAGTGTGGACTAGG - Intronic
1009662229 6:66629055-66629077 CATGCTGGAGAAAGTGGTGTGGG + Intergenic
1012178151 6:96115621-96115643 CATACTGGAAACTCTGCTCCAGG + Intronic
1015116132 6:129651592-129651614 TATGCTGGAAAGAGTTGTCTGGG - Intronic
1016442225 6:144095825-144095847 CATGCTGGGACTTGTGGTCTTGG + Intergenic
1016616423 6:146053732-146053754 CATGCTGGGAATGGTGTTCTGGG + Intronic
1017158403 6:151342269-151342291 CAGGCTGGAAAGTACGGTCTAGG + Intronic
1020510588 7:9051671-9051693 CAGGCTGGCTACTATGGTCTGGG + Intergenic
1022123077 7:27328931-27328953 CATTCTGGAAACTTTGGTGTTGG - Intergenic
1023124173 7:36938719-36938741 CATTTTGGATACTGTGTTCTTGG + Intronic
1024959574 7:54960191-54960213 AATGATGGAAATTGTGGTCAAGG - Intergenic
1026178081 7:68015178-68015200 CATGGAGGATCCTGTGGTCTTGG - Intergenic
1034053097 7:148004250-148004272 CATACTAGAAACTGTGTTCTAGG - Intronic
1034935006 7:155193369-155193391 CATCCTGGGAACTGTCCTCTTGG - Intergenic
1035141180 7:156763617-156763639 CTTACTGGAAACTGTAGTTTGGG - Intronic
1035308579 7:157950767-157950789 GATGCTGGAAGCTGTGATGTTGG + Intronic
1038488726 8:27954252-27954274 CATGCTGGGGGCTGTGTTCTCGG + Intronic
1038681117 8:29669533-29669555 CATGTTGGAAGCTGTGTTGTGGG - Intergenic
1040346301 8:46501051-46501073 CATGTTGGAAACACTGTTCTTGG - Intergenic
1040544767 8:48390299-48390321 CCTGCTGGAACCTGTGGCCGGGG - Intergenic
1041136916 8:54768843-54768865 CATGCTGGAAAATGTGCTTAGGG - Intergenic
1045028973 8:98117229-98117251 CATTCTGGGAACTGTAGTTTCGG + Exonic
1045660713 8:104434724-104434746 CATGCTAGGTACTGTGCTCTAGG - Intronic
1047274060 8:123391952-123391974 CCTGCTGGGAACTGTGGTGGGGG + Intronic
1049371132 8:142267973-142267995 CAGGAAGGAGACTGTGGTCTTGG - Intronic
1051342139 9:16121380-16121402 CATGCAGCCAGCTGTGGTCTGGG - Intergenic
1052866428 9:33467178-33467200 CATTCGGGAAGCTGTGGTCTGGG - Exonic
1053027759 9:34744686-34744708 TATGCTGGAAATTGTGCACTGGG + Intergenic
1054273839 9:63050102-63050124 CTGGCTGGGAACTGGGGTCTGGG + Intergenic
1054401001 9:64714866-64714888 CTGGCTGGGAACTGGGGTCTGGG - Intergenic
1054434608 9:65199180-65199202 CTGGCTGGGAACTGGGGTCTGGG - Intergenic
1055217137 9:73878532-73878554 CATGTTAGAAAGTGTGATCTTGG - Intergenic
1056208597 9:84343476-84343498 CTTGCAGGAACCTGTGGTCTGGG + Intergenic
1056831063 9:89917990-89918012 CATGGAGGACACTGTGGTGTGGG - Intergenic
1058629687 9:106973909-106973931 CTTTCTGGAAACTGTGCCCTGGG - Intronic
1060147492 9:121265504-121265526 CATGCTGTCAACTGTGTTGTGGG + Intronic
1187362277 X:18640172-18640194 CATGTTGGAAACTTTTGTCACGG - Exonic
1189297712 X:39930473-39930495 CATGCTGAGAATTGAGGTCTAGG + Intergenic
1192502300 X:71662172-71662194 CCTGGTAGAAACTGTGGGCTGGG - Intergenic
1195713729 X:107797496-107797518 CTGGATGGAAACTGTTGTCTAGG - Intergenic
1196796185 X:119503629-119503651 GATGCTGGAGACTGTGGGCTGGG - Intergenic
1197802091 X:130361678-130361700 CATGGTGGGGACTGTGGTCCTGG + Intronic