ID: 1108223646

View in Genome Browser
Species Human (GRCh38)
Location 13:48265222-48265244
Sequence TTGGGGAATGGGACTGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 548}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108223646 Original CRISPR TTGGGGAATGGGACTGAGGA AGG (reversed) Exonic
900103921 1:974194-974216 TGGGGAGATGGGACTGGGGAGGG + Intronic
900171384 1:1270823-1270845 TTGGGAGCTGGGAATGAGGAGGG - Intronic
900192188 1:1356338-1356360 GTGGGGAAGGGGACTCAGTAGGG + Intronic
900398166 1:2461814-2461836 TTGGGGAATGGCACCATGGAAGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
903172427 1:21562675-21562697 AGGGGGAAGGGGACTGGGGAAGG - Intronic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
903947397 1:26972329-26972351 TTGGGGAATAGGAAGGAGGCTGG + Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905968061 1:42116048-42116070 GTGGGGAGTGGGACTGGGGCAGG + Intergenic
907276683 1:53320726-53320748 CTGGGGAGTGGGACTGGGGAGGG - Intronic
907947034 1:59145262-59145284 TAGGGTAATGGGAATGAGCATGG + Intergenic
908322819 1:62994597-62994619 TTGGGGGATGGGACAGTGGATGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
910307616 1:85784448-85784470 TTATGGAATGGGCCTAAGGATGG - Intronic
910650198 1:89558459-89558481 TATGGAAATGGGACTAAGGAGGG + Intronic
911372138 1:97006353-97006375 CTGGGGAATGGGACTCAGAATGG + Intergenic
911936469 1:103981438-103981460 ATGGGGCATGGGGCGGAGGAGGG + Intergenic
912718729 1:112002097-112002119 TAGGGCAATGGTACTGGGGATGG + Intergenic
913346209 1:117813505-117813527 TGAGGGATTGGGACAGAGGAGGG + Intergenic
913369505 1:118082828-118082850 TGGGGGAAAGTGACTGAGGAAGG + Intronic
913491118 1:119380855-119380877 TTTGGGAATGGGAATGGGAATGG + Intronic
914902095 1:151716403-151716425 GCGGGGAAAGGGCCTGAGGAGGG + Exonic
916517900 1:165537212-165537234 TTGAGAAATGGAACTGAGAATGG - Intergenic
916683173 1:167122389-167122411 TTTGGAAATGGGACTGAGGCAGG - Intronic
917219401 1:172711608-172711630 TGGGGGAATGAGAGTGAGGATGG + Intergenic
917602110 1:176586436-176586458 TTGGGGTATGGGGGTGAGGGAGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917843006 1:178997624-178997646 TTGGGGAATAGGCCCAAGGAGGG + Intergenic
918083242 1:181223437-181223459 GTGGGGAGTGAGACTGAGGCGGG + Intergenic
918372079 1:183870575-183870597 TTTGGGACTGGGCCTGAGAAGGG + Intronic
918413054 1:184280763-184280785 ATTGGGAATGGGGCTGAGCACGG + Intergenic
919789414 1:201280892-201280914 TTGGTGCAAGGGACGGAGGAAGG + Intergenic
920183647 1:204147547-204147569 TTGGGGGGTGGGACAGCGGAAGG - Intronic
920748110 1:208647978-208648000 TGGGGGAAGGGGACTGAAGGGGG + Intergenic
920804876 1:209223607-209223629 CTGGGGAATGGAGCTGAGAAAGG - Intergenic
920971480 1:210746909-210746931 CTGCAGAATGGGACAGAGGAAGG + Intronic
921560267 1:216649349-216649371 TTGGTGAATGAAAATGAGGATGG - Intronic
921875315 1:220189087-220189109 GAAGGGAATGGGACTGAGGGGGG + Intronic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922912445 1:229229194-229229216 AAGGGGAATGGGAATAAGGAAGG - Intergenic
922994517 1:229945189-229945211 ATGGGGAATTGGGGTGAGGAGGG - Intergenic
923550484 1:234959340-234959362 TTGGGGGCTGGCAGTGAGGACGG - Intergenic
923825548 1:237495757-237495779 ATGGGGCATGGGGCTGAGGTAGG - Intronic
924113877 1:240726736-240726758 GTGGGGAATTGGACTGGAGATGG + Intergenic
924719052 1:246605923-246605945 CTTGGGACTGGGTCTGAGGAGGG + Intronic
924719354 1:246607747-246607769 TTTGGGACTGGGCCTGAGAAGGG + Intronic
924722247 1:246635050-246635072 CTTGGGACTGGGTCTGAGGAGGG + Intronic
924722990 1:246640028-246640050 CTTGGGACTGGGCCTGAGGAGGG + Intronic
1062911722 10:1216166-1216188 TTGGGGCATCAGACTGAGGTTGG + Intronic
1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG + Intronic
1063390266 10:5645712-5645734 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063390394 10:5646368-5646390 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063446847 10:6124103-6124125 TTGGAGAATGGGACTGGTGGAGG - Intergenic
1064795833 10:19010121-19010143 TTGGGAAATTTGACTGAGGGTGG - Intergenic
1064798995 10:19047233-19047255 TTGGGTAATTGGACAGAAGAAGG + Intergenic
1064822996 10:19360502-19360524 TTTGGGAATGAGAGTGAGCAGGG - Intronic
1065327565 10:24562689-24562711 ATGGGGAAAGGAACTGAAGATGG - Intergenic
1065818071 10:29500111-29500133 TGGGGAGATGGGGCTGAGGAGGG + Intronic
1065954847 10:30684394-30684416 TGAGGAGATGGGACTGAGGAGGG - Intergenic
1066433497 10:35375027-35375049 TTGGGGTATGAGACTAGGGAGGG + Intronic
1068076344 10:52260104-52260126 TGGGGGAATGGGAATGAGGGTGG - Intronic
1068100142 10:52542405-52542427 TTGGGGAATGGGTCTGAGAAAGG + Intergenic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1070503145 10:77090292-77090314 TTGGGGAATGGCACTGGGGATGG - Intronic
1070577014 10:77687050-77687072 TGGGAGGATGGGACTCAGGAAGG - Intergenic
1070607617 10:77910042-77910064 TCGGGGAATGGGTCTGATGCTGG - Intronic
1070805243 10:79266969-79266991 CAGTGGAATGGGGCTGAGGAGGG + Intronic
1071399723 10:85257376-85257398 TTGGGGAAAGTGCCTGGGGAGGG - Intergenic
1071827142 10:89336384-89336406 AAGGGCAATGGGAGTGAGGAGGG - Intronic
1072188209 10:93061529-93061551 ATGGGCATTGAGACTGAGGAGGG - Intronic
1073184351 10:101606813-101606835 TGGGGGAATGGGTGTGAGAAGGG + Intronic
1073496692 10:103898090-103898112 CTGGGGAATGGTCCTGAGGCAGG + Intronic
1073535849 10:104275759-104275781 TGGGTGAAGGGGACTGGGGAGGG - Intronic
1075549173 10:123379494-123379516 TTAGGCAATGTGGCTGAGGAGGG - Intergenic
1076071172 10:127490976-127490998 TAGGGAAAGGGGACTGGGGAGGG - Intergenic
1076212950 10:128664949-128664971 CTGGGGGATGGGAATGGGGAAGG + Intergenic
1077453826 11:2666182-2666204 CTGGAGAGTGGGACTGAGGGCGG - Intronic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1078178669 11:8990863-8990885 GTTGGGAGTGGGACTGAGAAGGG - Intronic
1078523080 11:12078897-12078919 TTGGGGAGTGGGATGGGGGAGGG - Intergenic
1078679433 11:13462515-13462537 TTTGGGAATGGGGCGGGGGAAGG - Intronic
1078708034 11:13764213-13764235 CTGGGGAGTGGGGCAGAGGATGG - Intergenic
1078917654 11:15795138-15795160 CTGGGGAGTGGGACTGGGGATGG + Intergenic
1079162624 11:18009068-18009090 TTGGGGAAGGGATTTGAGGAGGG - Intronic
1082093663 11:48109607-48109629 CTGGGAAATGGGTCTGGGGAAGG + Intronic
1082210677 11:49497916-49497938 TTGGGGAATGGAACTGATTCTGG - Intergenic
1083063595 11:59899823-59899845 CTTGGGACTGGGCCTGAGGAGGG + Intergenic
1083738597 11:64695560-64695582 TTAGGGGATGAGACTGAAGATGG - Intronic
1083997545 11:66279586-66279608 ATGGGAAATGGGATTGAGGGAGG - Intronic
1084021867 11:66422571-66422593 GTGGGAAATTGGACCGAGGAAGG - Intronic
1084482507 11:69430110-69430132 TGGGGGGCTGGGACTTAGGATGG - Intergenic
1085414323 11:76310213-76310235 GTGGAGAATGGGAGTGAGGTCGG - Intergenic
1085478598 11:76804166-76804188 TGGGGGAATGGGGCTGGGGGAGG - Intergenic
1085653544 11:78291130-78291152 TTGGGGAGTGTGACAGAAGAAGG + Intronic
1086638959 11:89126876-89126898 TTGGGGAATGGAACTGATTCTGG + Intergenic
1087044566 11:93833994-93834016 ATGGGCAATGGAACTGAGGCTGG - Intronic
1087049415 11:93870155-93870177 ATTGGGACTGGGCCTGAGGAGGG + Intergenic
1087400830 11:97665444-97665466 TTGAGGAATAGGACTGTTGAAGG - Intergenic
1088543599 11:110937860-110937882 TTGGGGACAGGGCCTGGGGAAGG + Intergenic
1088651653 11:111962588-111962610 TTGGGGAATGGGGGTGAAGCTGG + Intronic
1089196020 11:116694509-116694531 TTGGGGTATGGGAGTGTGGGGGG - Intergenic
1089406487 11:118201880-118201902 TTGGGGAGATGGGCTGAGGAGGG + Intronic
1090403517 11:126463768-126463790 TTGGGGAATGGGAGTCAGAGTGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1091297687 11:134485485-134485507 TTGGGGAAGGGGAGCCAGGAGGG + Intergenic
1091924117 12:4329966-4329988 ATGGGGAATGGTACTGGGGAGGG + Intronic
1093034958 12:14324245-14324267 TTGGTGAATGGGAAATAGGACGG - Intergenic
1093164934 12:15793132-15793154 TTGGGGAGTGGGAGTGAACAGGG - Intronic
1094799454 12:34016318-34016340 TTGGGGAATGAGACAAAGCATGG - Intergenic
1095112241 12:38310590-38310612 TTGAGGAATGGGACAAAGCATGG - Intergenic
1095273470 12:40250652-40250674 TTAGGGGATGGGACTGGAGAAGG - Intronic
1095954846 12:47800012-47800034 TCAGGGATTGGGGCTGAGGAGGG + Intronic
1096179536 12:49542958-49542980 TTGGGGGTTGGGACTGAAGGAGG + Intronic
1096313051 12:50538454-50538476 TTGGGAAGTGGGACTGGGCACGG - Intronic
1096628779 12:52912142-52912164 TGAGGGAAAGGGACTGAGGGCGG + Intronic
1096799823 12:54102806-54102828 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1097235792 12:57538577-57538599 TGGGGGAATGGGGATGAGGGAGG + Intronic
1097459563 12:59844002-59844024 TCAGGGTATGGGACAGAGGAGGG - Intergenic
1099862301 12:88235263-88235285 CTTGGGACTGGGCCTGAGGAGGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100671411 12:96816969-96816991 GTCGGGAATGGGAGTGAAGAGGG - Intronic
1102112596 12:110376025-110376047 TGGGGGAAGGCCACTGAGGAGGG - Intronic
1102409299 12:112703386-112703408 TTGGGGAATCTGACTAAGGATGG - Intronic
1102468192 12:113142761-113142783 CTGGGGAGTGGGGCTGAGGCAGG - Intergenic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1104382139 12:128316346-128316368 GTGGGGAAGGAAACTGAGGAAGG - Intronic
1104498122 12:129259863-129259885 TTGAGCAATGGGGCTGAGGTTGG + Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104818052 12:131659945-131659967 TTGGGGGATGGGAATGGGGAGGG + Intergenic
1105675080 13:22662340-22662362 TTCGGGGAGGGGACAGAGGACGG + Intergenic
1105683298 13:22752058-22752080 GTGGGGAAAGGGAGTGAGGCGGG - Intergenic
1106617895 13:31347260-31347282 CTTGGGACTGGGCCTGAGGAAGG - Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108544783 13:51481962-51481984 GTGGAGAATGGGAGTGATGAAGG - Intergenic
1108639768 13:52372121-52372143 TTTGGAAGTGGGACTGAGGCTGG - Intergenic
1108722039 13:53142080-53142102 ATGGGGGATGTGACTGAGGCTGG - Intergenic
1108756128 13:53504554-53504576 TTGGGTAATAGGACTGAGGCAGG - Intergenic
1109398550 13:61793381-61793403 TTGGGCAATGGGCCTAAGAAGGG + Intergenic
1110933638 13:81254497-81254519 TTAGAGAATGGAAGTGAGGATGG - Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111588527 13:90312609-90312631 TTTGGGAAGGGTCCTGAGGAAGG + Intergenic
1112541499 13:100318059-100318081 TACGGAAAAGGGACTGAGGAAGG - Intronic
1112719813 13:102230545-102230567 TTGGGGAGTGGGCCTCATGAGGG + Intronic
1113183943 13:107664544-107664566 TTGGGGAGTGGCGGTGAGGAAGG - Intronic
1113322211 13:109245056-109245078 TTGGGGAATGAGTCTGTAGACGG + Intergenic
1114444828 14:22780411-22780433 ATGGGGAATGGGAGGTAGGAGGG - Intronic
1114758166 14:25283247-25283269 TTGGGGAATAGGTATGTGGATGG - Intergenic
1116081021 14:40172400-40172422 TTGAGGAATAGGAATGAGAAAGG - Intergenic
1116885228 14:50214203-50214225 TTGGGGAATGGGGAAGTGGAAGG + Intronic
1116895330 14:50310589-50310611 TTGGGGAGGGGGGCTGAGGAGGG + Intronic
1117536796 14:56710266-56710288 TAAGGGAATGGGAAGGAGGAAGG + Intronic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1119777534 14:77258193-77258215 TTGGGGGAGGGGGCTGAAGAGGG - Exonic
1119837249 14:77761432-77761454 TCGGGGAACGGGACTGAGTAAGG - Intronic
1119984222 14:79117636-79117658 ATGGTGAGTGGGAGTGAGGAAGG + Intronic
1121189076 14:92008245-92008267 TTAGAGAATGGAAGTGAGGAAGG - Intronic
1122228053 14:100291228-100291250 TTGGGGCCTGGGGCAGAGGAGGG - Exonic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122804654 14:104250332-104250354 ATGGGGAATGGGGCCGAGGCCGG + Intergenic
1122919475 14:104874121-104874143 TTGGGGAGGGGGTCTCAGGACGG + Intronic
1123110046 14:105863001-105863023 TTGGAAAATGGGACTCAGGTTGG - Intergenic
1202865463 14_GL000225v1_random:114408-114430 TTGGGGGATGGGGCTGGGGAGGG - Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1124660186 15:31541775-31541797 TGGGGAATTGGGACTGGGGATGG + Intronic
1125351573 15:38772791-38772813 TTGGGGAGTGGGAGTGGAGAGGG + Intergenic
1125754897 15:42056972-42056994 TTGGGGGATGTGCCTGAGGATGG + Intergenic
1128199981 15:65796561-65796583 TTGGGGAACGGGGCTGAGGGTGG + Intronic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1129025235 15:72565786-72565808 ATGGGGAATGGGAAGGAGCAGGG - Intronic
1130012332 15:80161329-80161351 CTGTGCAATGGGACTGAAGATGG + Intronic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130263834 15:82380709-82380731 TAGGGGTATTGGACGGAGGAAGG + Intergenic
1130551919 15:84894917-84894939 CTGGGGGATGAGACAGAGGAGGG - Intronic
1130889344 15:88120084-88120106 TTGGGGCATTGGACTGAGAAGGG - Intronic
1130923543 15:88368532-88368554 TCTAGGAATGGGACAGAGGATGG + Intergenic
1131000912 15:88939238-88939260 TTTGGGACTGGGCCTGAGAAGGG + Intergenic
1131654238 15:94438393-94438415 GAGAGGAATAGGACTGAGGAAGG + Intronic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133532276 16:6666235-6666257 TTGAAGAATGTGACTGAGGCCGG + Intronic
1133997926 16:10762124-10762146 TGGTGGCAGGGGACTGAGGAGGG + Intronic
1134406331 16:13962220-13962242 GTGGGGAATGGGAGTGAGACTGG - Intergenic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134685513 16:16155431-16155453 TGGAGGGATGGGATTGAGGATGG - Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1135057242 16:19241326-19241348 TGGGGGATTGGGGCTGGGGAGGG + Intronic
1135244603 16:20844872-20844894 TTGGGGAAGGAAACTGGGGATGG + Intronic
1135556031 16:23437330-23437352 TGGGGGAGTGGGAGTGGGGATGG - Intronic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1135725990 16:24854196-24854218 TTGGGGAGTGGGGCAGAGGGAGG - Intronic
1136240041 16:28937973-28937995 ATGGGGGATGGGGCTCAGGATGG - Intronic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137436618 16:48459805-48459827 TAGGGGAAAGGGAATGAGGGAGG - Intergenic
1137982102 16:53078733-53078755 TAGGGGAATGGAAGTGGGGAGGG - Intronic
1138199026 16:55075292-55075314 TTGGGCATTGGGGCAGAGGATGG + Intergenic
1138252174 16:55509522-55509544 AGGGGGCATGGGTCTGAGGAGGG + Intronic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138532774 16:57643796-57643818 TTGGGGAGTGGGAATGGGGGAGG + Intronic
1139109322 16:63869619-63869641 TTGGGTTATGGGTTTGAGGAAGG - Intergenic
1139512700 16:67436417-67436439 GTGGGGAATGGGGCTGGGAATGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140289714 16:73641749-73641771 TTGGGGAATAGGATTGGGGTGGG + Intergenic
1140486016 16:75294095-75294117 CTGGGGGATGGGACTGTGCAGGG - Intronic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1142018094 16:87762760-87762782 ATGGGCACTGGGACTGAGGCGGG - Intronic
1142759617 17:2035052-2035074 TTGGGGAAGGGGGTGGAGGAGGG + Intronic
1142898013 17:2994687-2994709 TGGGGGAATGGCACCGGGGATGG + Intronic
1143262967 17:5614060-5614082 TGGGGGAGATGGACTGAGGAGGG - Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143481117 17:7227880-7227902 ATGGGGAATGGGTGGGAGGAGGG - Intronic
1144629421 17:16862941-16862963 TTCAGGAAAGGGACTGAGGGAGG + Intergenic
1144652006 17:17013175-17013197 TTCAGGAAAGGGACTGAGGGAGG - Intergenic
1144706409 17:17371230-17371252 TGGGGGATTGGAACTGGGGAGGG - Intergenic
1145077976 17:19870792-19870814 GCCAGGAATGGGACTGAGGAAGG + Intergenic
1145157727 17:20554054-20554076 TTTGGGAGTGGGAATGGGGATGG - Intergenic
1145160994 17:20573507-20573529 TTCAGGAAAGGGACTGAGGGAGG + Intergenic
1145923897 17:28631749-28631771 GAGGGGAATGGAACTGAGAAGGG + Intronic
1147426986 17:40350641-40350663 TTGGGGGATGGGATGGGGGAGGG + Intronic
1148232857 17:45947934-45947956 CTAGGGAATGGGAGTGGGGAAGG - Intronic
1150516123 17:65811202-65811224 TTGGGGATTGCCAATGAGGAAGG + Intronic
1150683652 17:67303085-67303107 TTGGGGAAGGGAGCTGGGGATGG - Intergenic
1150833130 17:68541266-68541288 TTGGTGAGAGGGACTGTGGAGGG - Intronic
1151393527 17:73803941-73803963 ATGGGGAATGGGAGGGAGAAAGG - Intergenic
1151550184 17:74818240-74818262 TTGGGGGATGGGGCTGGGCAGGG - Intronic
1151572018 17:74931183-74931205 TTGGGAGAAGAGACTGAGGAAGG + Intronic
1152123820 17:78434629-78434651 ATGGGGGATGGGATAGAGGATGG + Intronic
1152123827 17:78434648-78434670 ATGGGGGATGGGATAGAGGATGG + Intronic
1152136103 17:78504651-78504673 TTGGGTAATGAGACAGGGGAGGG + Intronic
1152635654 17:81429593-81429615 TGGGGGAAGGGGAGTGAGGTGGG + Intronic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1156347016 18:36266487-36266509 TTGGAGAATGGATTTGAGGAAGG - Intronic
1157744188 18:50120545-50120567 TGGGGGAAGAGGGCTGAGGACGG - Intronic
1157879901 18:51311570-51311592 TTGGGGTAAGGGAGAGAGGATGG + Intergenic
1157918957 18:51696662-51696684 TTTGGGACTGGGCCTGAGAAGGG - Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1158960207 18:62581962-62581984 TTGGGGAAGGGGACGCAGGCTGG + Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1160062565 18:75546369-75546391 TGAGGGAATGGGAGTGACGATGG + Intergenic
1161637891 19:5400669-5400691 TTGGAGGGTGTGACTGAGGAGGG + Intergenic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1163493170 19:17629189-17629211 ATGCTGAATGGGGCTGAGGAGGG + Intronic
1164237261 19:23348030-23348052 TTGGGTAATTTGTCTGAGGAAGG - Intronic
1164614696 19:29660032-29660054 TTGTGGAATGGGGCTGGGAAAGG - Intergenic
1164869210 19:31629202-31629224 TTGGGGATGGGGACTTGGGAGGG - Intergenic
1165066485 19:33232143-33232165 TTGGGGATAGGAACTGAGGAGGG + Intergenic
1165258108 19:34592192-34592214 TTGGGCAGTGGGAGTGAGGGAGG + Intergenic
1165392587 19:35546935-35546957 TAGGGGAATGCAGCTGAGGAAGG - Exonic
1165402432 19:35610376-35610398 TAGGTAAATGGGAATGAGGAAGG - Intergenic
1165782178 19:38441209-38441231 TTGGGGAACGGGTCTCAGGAGGG + Intronic
1165881272 19:39045727-39045749 TTGTGGAATGTGAGGGAGGATGG - Intergenic
1165895710 19:39139689-39139711 TTGGGGAGTGGGCAGGAGGATGG - Intronic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166527144 19:43518889-43518911 TTGGGGAATGCGAGTGAAAATGG - Intronic
1166557317 19:43709271-43709293 TTGGGGAAGGGGTTTGGGGAAGG - Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167074648 19:47240922-47240944 TGGGGGTCTGGGACTGGGGAGGG - Intergenic
1167262757 19:48468315-48468337 ATGGGGAATGGAACAGGGGAAGG - Intronic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167766699 19:51488084-51488106 TTGGGGTGAGGGACAGAGGAGGG - Intronic
1168512833 19:56987249-56987271 TTGCGGAATGGGAGCGAGGTCGG - Intergenic
926156180 2:10455156-10455178 GTGGGGAATGGGTCTGAGAGCGG + Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
927200629 2:20575928-20575950 TGGGGGAAGGGGACTGGGGAGGG + Intronic
928017383 2:27670496-27670518 TTAGGGAAGAAGACTGAGGATGG - Intronic
928076048 2:28265560-28265582 TTGGGGGATGGGAAAGAGGTAGG + Intronic
929353355 2:40988555-40988577 TGGGGTAATGGGACTGTGGCAGG - Intergenic
929440316 2:41961011-41961033 TTGGGCAAAGAGACTGGGGATGG - Intergenic
929576515 2:43055956-43055978 TTGGGGAATGGGGATGAAGTTGG + Intergenic
930533011 2:52613946-52613968 CTTGGGACTGGGCCTGAGGAGGG - Intergenic
931685244 2:64786869-64786891 TGGGGGAATGAGGGTGAGGATGG + Intergenic
931912919 2:66921888-66921910 TTGGGGAGTGGGAACCAGGATGG + Intergenic
932618433 2:73251098-73251120 TTGGGGCTTGGGATGGAGGAAGG + Intronic
932751869 2:74376356-74376378 TGGGGGAATGGGGCTGAGGAAGG - Intronic
932836984 2:75047041-75047063 TTGGAGACTGGGTCAGAGGAAGG + Exonic
933034496 2:77376433-77376455 TTGGGGATGGGGACTGAAAAAGG - Intronic
933326069 2:80839098-80839120 GTTGGGGATGGGAGTGAGGATGG - Intergenic
933603703 2:84359813-84359835 TTGGGGTAAGGGGCTGGGGAGGG + Intergenic
933871921 2:86574954-86574976 TTGGGGTGTGGGAAGGAGGATGG - Intronic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
934886533 2:98030243-98030265 TGGGGGGCTGGGACTGTGGAAGG + Intergenic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935225123 2:101046466-101046488 TTGGGGACTGGGGTTGTGGAGGG + Intronic
936996583 2:118421002-118421024 TTGGGAAATGGGGTTGAGTAGGG - Intergenic
937265749 2:120613769-120613791 TTGGGCAATGGGACACAGGACGG - Intergenic
937845902 2:126578648-126578670 TTGGAAAATGGGACTGAGGGTGG + Intergenic
938139925 2:128787081-128787103 TGGGGGAATGGGAATGAGGTCGG + Intergenic
938378362 2:130823169-130823191 TTTGGGGGTGGGATTGAGGAAGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938837094 2:135115950-135115972 GGGGGGAATGGGGCTGATGAGGG + Intronic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939461080 2:142495559-142495581 GTGGGGGCTGGGACTGAAGAAGG - Intergenic
939678245 2:145098592-145098614 TTGAAGACTGGGACTTAGGAGGG - Intergenic
939680939 2:145130945-145130967 TTAGGAGATGGAACTGAGGAAGG + Intergenic
939936381 2:148298389-148298411 CTGGTGAGTGGGAGTGAGGAAGG + Intronic
940427965 2:153552529-153552551 TTGTGGAATGAGACTGGTGAAGG + Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
941795587 2:169595538-169595560 ATGGGGACTGGAAGTGAGGATGG - Intronic
941936645 2:170986939-170986961 TTGGGGGGTGGGCCTGAGAATGG - Intergenic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942313892 2:174681677-174681699 TGGGGGAATGGGAGTGGGGTGGG + Intronic
942705844 2:178771056-178771078 TTGTGGAATGTGTCTCAGGAAGG + Intronic
942928008 2:181457054-181457076 TCGGGGAGTGGGACTGCGGCGGG - Intergenic
944419989 2:199519331-199519353 TTTGTGAATGGGAATGAAGAAGG + Intergenic
944678759 2:202056606-202056628 TTCTGGAATGGGTCTGAGGTGGG + Intergenic
945260180 2:207835874-207835896 TGGGGGGATGGGGATGAGGAGGG + Intronic
945701761 2:213179256-213179278 TTGGGGAAAGGGCAAGAGGAAGG + Intergenic
945987770 2:216369340-216369362 TTGGGATATGGGACTGAAGATGG + Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946881296 2:224179721-224179743 AGGGGGAAGGGGACTGAGGGTGG + Intergenic
947224134 2:227823930-227823952 TTGGGAAAAGGGACAGAGGATGG + Intergenic
948477007 2:238226811-238226833 TTGGAGGATGAGACAGAGGAGGG - Intronic
1168967895 20:1910439-1910461 CTGGGAAATGGGACTGAGGTAGG - Intronic
1169150633 20:3286704-3286726 TGGGAGAGTGGTACTGAGGAAGG - Intronic
1169324091 20:4661258-4661280 CTTGGGACTGGGCCTGAGGAAGG - Intergenic
1169465767 20:5836973-5836995 TGGGGCAATGGGGCAGAGGAAGG + Intronic
1169801285 20:9514929-9514951 TTGGCGACTGGGAGAGAGGACGG + Intronic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170533025 20:17313581-17313603 TTGGGGAATGAGGTTGATGAGGG - Intronic
1171127844 20:22620010-22620032 TTGGGGGAGGGGAATGGGGAAGG + Intergenic
1171796616 20:29571541-29571563 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1171851625 20:30312625-30312647 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1171958695 20:31478014-31478036 TTGGGGGAGGGTGCTGAGGATGG - Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1173180780 20:40804820-40804842 TTGGATTATGGGAGTGAGGAGGG - Intergenic
1173406755 20:42773056-42773078 CTGGGCACTGGGAATGAGGATGG + Intronic
1173521161 20:43701325-43701347 TTGGGGTGTGGGCCTGAGGTCGG + Intronic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174575921 20:51537150-51537172 TTAGGGAATGGGACACAGAAGGG + Intronic
1174582906 20:51585286-51585308 TTGGGGGTTGGGAGTGGGGAGGG - Intergenic
1174708980 20:52685264-52685286 TTGGGGAGTGGGAGTGGGGCGGG - Intergenic
1174729455 20:52901423-52901445 TTCAGGCATTGGACTGAGGATGG - Intergenic
1175067923 20:56305825-56305847 ATGGGAAATGGGCTTGAGGAGGG + Intergenic
1175148939 20:56917858-56917880 ATGGGAATTGGGACTGGGGAGGG - Intergenic
1175465669 20:59189879-59189901 TTGGGGAACGGAGCTGGGGATGG + Intergenic
1175845268 20:62054914-62054936 TTGTGGAATGAGATTGAGGTGGG - Intronic
1176383195 21:6123972-6123994 CTGGGGAAGGGTCCTGAGGAGGG - Intergenic
1177218096 21:18155271-18155293 TTGGGGACTGGGATTGGGTAAGG - Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178493314 21:33067934-33067956 TTGGGGATTGGGTGTAAGGATGG - Intergenic
1178699400 21:34820288-34820310 TTGCTGAGTGGGGCTGAGGAGGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179740272 21:43414267-43414289 CTGGGGAAGGGTCCTGAGGAGGG + Intergenic
1179967255 21:44814674-44814696 TTCGGGAATCCAACTGAGGACGG + Intronic
1180182264 21:46123291-46123313 TTGGGGGAGGGGACTCTGGAGGG - Intronic
1180720397 22:17903617-17903639 TTTGGGAATGGGACTCAGAAGGG - Intronic
1181455594 22:23058640-23058662 ATGGGGCATGGGGCTGAGGTTGG - Intergenic
1181887140 22:26030397-26030419 TTGATGAATGGGACAAAGGATGG - Intronic
1182194219 22:28497830-28497852 GTGAGGAATAGGGCTGAGGATGG + Intronic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183235475 22:36613840-36613862 TTGGGAAATGGGCTGGAGGAAGG - Intronic
1183263324 22:36810418-36810440 TAGGGGGTTGGGAGTGAGGAAGG + Intronic
1183323821 22:37180767-37180789 TTGGTGGAAGGGACTGAGCAAGG + Exonic
1183455689 22:37922009-37922031 TATGAGAATGGGCCTGAGGAGGG + Exonic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183692249 22:39397064-39397086 TGGGGAAATGGGTCTGGGGAAGG + Intergenic
1184206217 22:43005418-43005440 TTGGGGTAAGGGCCTGATGATGG - Intronic
1184606187 22:45576088-45576110 AGGGGGACTGGGACTGGGGACGG - Intronic
1184978534 22:48080284-48080306 TTTGGGAATGAGAGTGAAGAGGG + Intergenic
949408459 3:3739134-3739156 TTGGGGATTCGGACTTTGGATGG + Intronic
950094484 3:10320959-10320981 TTGGGATTTGGGACTCAGGACGG + Intronic
950134441 3:10570852-10570874 TCGGGGCATGGCAGTGAGGAGGG - Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950300044 3:11868932-11868954 CTGAGGAATGGGACAGAGAATGG - Intergenic
950458877 3:13109252-13109274 TGGGAGAATGGGAGGGAGGAGGG - Intergenic
950798224 3:15528590-15528612 TTGGGGACTGGGATTGGGGTAGG - Intergenic
951496876 3:23338596-23338618 TTGGGGACTGGGACTGGGACTGG + Intronic
952496367 3:33919383-33919405 TGGAGGAATGGGATGGAGGAGGG + Intergenic
952534704 3:34297283-34297305 TAGGGGAATGGTCCTCAGGAAGG + Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
953027765 3:39154449-39154471 TTGGGAAGTGGGGCTGAGGGTGG - Intronic
953330620 3:42050164-42050186 TTGGGGAAGGGAACTGAGGGTGG + Intronic
953476419 3:43209476-43209498 TGGGGAAAGGGGACTGAGAAGGG + Intergenic
953574255 3:44100358-44100380 TCGGGGAAAGGGAATGAGCATGG - Intergenic
953790738 3:45945996-45946018 TTAGGAAATGGGGCTCAGGATGG + Exonic
954411605 3:50373600-50373622 GTGGGGAGTGGGACTGAAGGGGG + Intronic
954758588 3:52857404-52857426 TTGGGGGCTGGAACTCAGGAAGG + Intronic
955231318 3:57101465-57101487 TTGGGGAATGGGACTGCTCTAGG - Intronic
955651239 3:61196540-61196562 TTGCTGAATTGGGCTGAGGATGG + Intronic
955766216 3:62346876-62346898 TGGGGGAATATGACTTAGGAAGG + Intergenic
955796703 3:62644733-62644755 TTGAGCAATGGGAGTGGGGATGG - Intronic
956413656 3:69004714-69004736 TTGGGGAATGGGTGGGGGGATGG - Intronic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958783462 3:98570815-98570837 ATGGAGAATGGAACTGAGGCAGG - Intronic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960719936 3:120616105-120616127 CTTGGGACTGGGCCTGAGGAGGG + Intergenic
961602742 3:128073594-128073616 TTGGGGCAGGGGAGTGAGGTGGG - Intronic
961622146 3:128232567-128232589 GGGGGGAAGGGGACTGAGGCGGG + Intronic
961998505 3:131271026-131271048 TTGGGGAGTGGGCAAGAGGAAGG - Intronic
962285216 3:134079334-134079356 ACGAGGACTGGGACTGAGGAGGG + Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
964612223 3:158627053-158627075 TTGGGGAGGGGGACTTAGGCTGG + Intergenic
965384641 3:168031515-168031537 TTGGGGTATGGCAGGGAGGATGG - Intronic
965661809 3:171049922-171049944 TTGGGGAGTGGGGGTGAGGTGGG + Intergenic
965794743 3:172428111-172428133 CTGGGGCATGACACTGAGGAGGG - Intergenic
966129792 3:176624555-176624577 GTGGAGAGTGGTACTGAGGATGG + Intergenic
966247982 3:177830207-177830229 TATGGGAATGGTACTGAGCATGG + Intergenic
966861943 3:184235348-184235370 TGGGGCAGTGGGTCTGAGGAGGG + Intronic
966871214 3:184291534-184291556 CTGGTGAATGGGGCTGAGGCTGG + Intronic
966885724 3:184377173-184377195 GTGGGGAGTGGGGCTGGGGAGGG + Intronic
968923844 4:3536689-3536711 TGGGGGAAGGGGTCTGAGAAGGG - Intergenic
969211066 4:5687580-5687602 TTGGGGCAAGGGACTGGGTAGGG + Intronic
969618753 4:8268502-8268524 TCGGGGAATGGGAAGGTGGAGGG - Intergenic
970674017 4:18428016-18428038 TTAGGAAATGTGACTGAGGCAGG - Intergenic
970794450 4:19894029-19894051 CTTGGGAATGGGCCTGAGAAGGG - Intergenic
972814794 4:42632113-42632135 TTGAGGAATGGAACTGAGCAAGG + Intronic
973747531 4:53978382-53978404 TTTGGGAATGGGATTGGGGTGGG + Intronic
973808157 4:54545326-54545348 TCTGGGCATGGGATTGAGGAGGG + Intergenic
974017792 4:56664777-56664799 CTGGGGAATGGTGGTGAGGAAGG - Intronic
974886976 4:67831531-67831553 TTGGTGATTGGGACTGAATAGGG + Intronic
975811378 4:78173528-78173550 CTTGGGAATGGGACTGGGAATGG - Intronic
978898982 4:113926183-113926205 TTGGGGAATAGGTATGTGGATGG - Intronic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
981159758 4:141483949-141483971 GTGGGGAAGGGGACTGCAGAGGG - Intergenic
981688559 4:147481397-147481419 TCGGGGACTGGGACTGGGGCGGG + Intronic
982029100 4:151281237-151281259 CTGGGGAATGAGACTGGTGATGG + Intronic
982309825 4:153973327-153973349 CTGGGGAATCTGACTTAGGACGG - Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983518448 4:168680550-168680572 TTTGGGAATGGCATTTAGGAAGG + Intronic
983803623 4:171966366-171966388 TTGGTGAATGAGAGTGGGGATGG + Intronic
983856089 4:172647174-172647196 TGGGTGAAAGGGAATGAGGATGG - Intronic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
986064982 5:4226741-4226763 TTGGGCACTGGGACTGAGCCAGG - Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
989003418 5:36784037-36784059 CTTGGGACTGGGCCTGAGGAGGG - Intergenic
991860818 5:71011509-71011531 TTGGGTGGTGGGATTGAGGATGG - Intronic
991923682 5:71683013-71683035 TGGGGGGGTGGGACTGAGGTAGG + Intergenic
992466078 5:77006357-77006379 TAGGTGAAAGGGAATGAGGAGGG - Intergenic
993677014 5:90828349-90828371 TTGGAGAATATTACTGAGGAGGG - Intronic
994063897 5:95512884-95512906 TTTGGCAATGGTGCTGAGGAAGG - Intronic
994313305 5:98302424-98302446 TTGGGCAATGGGACTGGAGTAGG - Intergenic
995571374 5:113486037-113486059 TTGGGGAATGGGGCTAATGAAGG - Intronic
995838481 5:116421435-116421457 TTGGGGAGGGTGACTGGGGAAGG + Intergenic
995852309 5:116559298-116559320 TTGCGGACTGGGCCTGAGGAGGG - Intronic
995950042 5:117700930-117700952 TTGGCTAATGGAACTGAGGGTGG + Intergenic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
996767551 5:127049398-127049420 ATGGGGATTGGGAGTAAGGAGGG - Intronic
997295195 5:132764558-132764580 CTGGGGAATGGGGGTGATGAGGG - Intronic
998129778 5:139645860-139645882 TTGGGGAAGGGGGCTGTGGTGGG + Intergenic
998370112 5:141655477-141655499 GTGGGGAATGGGGGTGAAGAAGG + Intronic
999265209 5:150262518-150262540 ATGGGGAATGGGAGTGGGGGTGG - Intronic
999448142 5:151657934-151657956 TAAGGGAAGGGGAGTGAGGAAGG - Intergenic
999511883 5:152260756-152260778 ATGGGGAATGTGAGTGAGAATGG + Intergenic
1001831576 5:174793759-174793781 CTGGGGTAGGGGACTGCGGAGGG - Intergenic
1002618264 5:180468792-180468814 TGGGGGAATGGTGCTGAGAACGG + Intergenic
1002796034 6:471585-471607 TTGCTGCATGGGACCGAGGACGG - Intergenic
1005351839 6:24943804-24943826 TGGGGGAATGGGACTTTGGGGGG - Intronic
1005682927 6:28224921-28224943 TCGGGGAGTGGGACTAAGGAGGG + Intronic
1006296330 6:33171675-33171697 TTGGGGAGGGGTACTGGGGAGGG - Intronic
1006510233 6:34517476-34517498 TTGGGGGAGGGAACTGGGGAGGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007494812 6:42252457-42252479 TTCGGGGCTGGGACTCAGGATGG + Intronic
1007536807 6:42598566-42598588 TTGGGGTGTGGGAGTGAGTAGGG + Intronic
1007817901 6:44537725-44537747 TGGAGGAATGGTACTGAGGTAGG + Intergenic
1008771458 6:54983500-54983522 CTTGGGACTGGGCCTGAGGAGGG + Intergenic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009950916 6:70394675-70394697 CTTGGGACTGGGCCTGAGGAGGG - Intergenic
1010433742 6:75807437-75807459 TTGGGGAGTGGGCATGTGGAGGG + Intronic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1010981504 6:82375156-82375178 GTGTGGCATGGGACTGAGGAGGG + Intergenic
1011161665 6:84397518-84397540 TTGGGGAATGGGGTTGGGGGAGG + Intergenic
1011758878 6:90536727-90536749 TTGGGGGCTGGGGCTGATGACGG + Intronic
1012370410 6:98498656-98498678 TGGGGGTGTGGGAGTGAGGAGGG + Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1012924436 6:105253529-105253551 TTTGGGAATGGCACTGCTGACGG + Intergenic
1014851381 6:126343528-126343550 TTGGGGACTGGGACTGGGACTGG - Intronic
1017059690 6:150470431-150470453 TTGAGGACTGGGAATGAGCAGGG - Intergenic
1017149537 6:151265976-151265998 TTGGGGGACTGGACTGATGATGG + Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017533615 6:155323063-155323085 TTTGGGGATGGGAGTGAGGAAGG + Intergenic
1018047452 6:159978294-159978316 TGGGGGAATCTGAGTGAGGAAGG - Intronic
1018089228 6:160331175-160331197 CTGGGAAGTGGCACTGAGGAAGG + Intergenic
1018842622 6:167528869-167528891 TTGGGATCTGGGGCTGAGGAGGG - Intergenic
1019832737 7:3349387-3349409 AAGGGGAATGGGGCTGGGGAGGG + Intronic
1021196297 7:17678240-17678262 TTGGGGCATGGGAGTGAAGAAGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021410387 7:20323564-20323586 TTGGAGAAGGGGGCTGAGAATGG + Intergenic
1021656769 7:22880974-22880996 TTGGCATATGGCACTGAGGAAGG + Intergenic
1021930832 7:25579746-25579768 TCGGGGAATCAGTCTGAGGATGG - Intergenic
1022849329 7:34244154-34244176 TTGGGGACTGAAACTGGGGAAGG - Intergenic
1023444986 7:40222122-40222144 ATGGTGACTGGGGCTGAGGAGGG + Intronic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1025085581 7:56020660-56020682 TGGGGGACTGGGACTGCAGAGGG + Intronic
1026057840 7:67000224-67000246 TTAGAGAATGGGACTGGGCACGG - Intronic
1026361443 7:69604559-69604581 GTGGGGAATGGGACCTAGAAGGG + Intronic
1026720262 7:72824811-72824833 TTAGAGAATGGGACTGGGCACGG + Intronic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1030636448 7:111954535-111954557 CTTGGGACTGGGCCTGAGGAGGG - Intronic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1031426641 7:121613524-121613546 TTAGGGATGGGGACTGAAGAAGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032107245 7:129043300-129043322 TGGGGGTAGGGGACTGAGGTGGG + Intronic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032842769 7:135727189-135727211 TGGGGGAATGGGACTGGGATAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034453192 7:151148941-151148963 CTGGGGACTGGAGCTGAGGAGGG - Exonic
1034502446 7:151459612-151459634 CTGGGGACTTGGACTGAGGGGGG - Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035516705 8:239805-239827 TTTGGGAAAGGGACAGAGGCTGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035696779 8:1603769-1603791 TAAGGGACTGGGGCTGAGGAGGG + Intronic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1036808774 8:11853143-11853165 GTGGGGTATGGGACAAAGGAGGG + Intronic
1037378067 8:18253370-18253392 TAGGGGGATGGGAGTGGGGATGG + Intergenic
1037784327 8:21893495-21893517 TTGGGGCATTGGGCGGAGGAAGG + Intergenic
1037895744 8:22653608-22653630 TTGGGGGATGGAACTAAGGAAGG - Intronic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1038212650 8:25533858-25533880 ATGCAGAATGGGACTGAGGGAGG - Intergenic
1038863388 8:31412270-31412292 TTGGGGATTGTGACTGATGGTGG + Intergenic
1038999313 8:32962228-32962250 TAGGGGAATGAGATTGGGGATGG + Intergenic
1039481270 8:37875097-37875119 TTGGGGGATGGGGAGGAGGACGG + Exonic
1042157649 8:65863284-65863306 CTTGGGACTGGGCCTGAGGAGGG - Intergenic
1042158682 8:65870132-65870154 CTTGGGACTGGGCCTGAGGAGGG - Intergenic
1043768743 8:84169871-84169893 CTTGGGACTGGGCCTGAGGAGGG + Intergenic
1043856720 8:85273520-85273542 CTTGGGACTGGGCCTGAGGAGGG - Intronic
1043857423 8:85277934-85277956 CTTGGGACTGGGCCTGAGGAGGG + Intronic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044621272 8:94192760-94192782 TTGGGAAATGGTACTGAACAGGG - Intronic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1046036119 8:108843530-108843552 TTGGAGATTGGGAGTTAGGAAGG + Intergenic
1046710712 8:117508359-117508381 TTAGGGAATGGGGCTTAGAAAGG - Intergenic
1047195563 8:122718201-122718223 TTGTGGGATGGGATTGAGGTGGG - Intergenic
1048421581 8:134283289-134283311 GTGGGGAATGTGAGTGAGCATGG + Intergenic
1049144064 8:140984728-140984750 TGAAGGAGTGGGACTGAGGATGG - Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1049865004 8:144929453-144929475 TTGGGGAGTGGTAAAGAGGATGG + Intergenic
1049922566 9:379020-379042 TTTGTGGATGGGAGTGAGGAGGG + Intronic
1051970346 9:22879748-22879770 TTGGGGGATGGCAATGAGGATGG + Intergenic
1052691842 9:31825238-31825260 TTGGTGAAAGGGACTGTGGAGGG + Intergenic
1053314714 9:37041588-37041610 TTGAGGAACGGGACAAAGGAAGG + Intergenic
1053789403 9:41675880-41675902 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1054145660 9:61559284-61559306 TGGGGGAAAGGGTCTGAGAAGGG + Intergenic
1054155740 9:61638882-61638904 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054187967 9:61967774-61967796 TGGGGGAAGGGGTCTGAGAAGGG - Intergenic
1054465399 9:65490388-65490410 TGGGGGAAAGGGTCTGAGAAGGG + Intergenic
1054475508 9:65569883-65569905 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054650548 9:67620807-67620829 TGGGGGAAGGGGTCTGAGAAGGG + Intergenic
1055262556 9:74454905-74454927 CTGGGGAATGGGCCTCATGAGGG + Intergenic
1056469297 9:86889751-86889773 CTGGGGAATGGGAATAATGAAGG - Intergenic
1056804485 9:89718124-89718146 TTGGGGACTTGGACTCAGGAAGG + Intergenic
1058286853 9:103189285-103189307 CTTGGGACTGGGCCTGAGGAGGG + Intergenic
1058985824 9:110207692-110207714 AAGAGGAGTGGGACTGAGGAAGG + Exonic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1061750334 9:132772687-132772709 TGGAGGAATGGGGTTGAGGAGGG - Intronic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062462231 9:136666746-136666768 TTGGGGAGTGGGACCCGGGAAGG - Intronic
1203738876 Un_GL000216v2:161748-161770 GTGGGGGATGGGGCTGGGGAGGG + Intergenic
1187233534 X:17444830-17444852 TTGGGAAATGGTGCTGAGAAGGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187774131 X:22736094-22736116 TTGGGGAGTGGGATAGAGAAGGG + Intergenic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1188221221 X:27543786-27543808 GTGGAGAATGGGACTGAGACAGG + Intergenic
1188571072 X:31585515-31585537 TTTGGGAGTGGGAATGAGTAGGG - Intronic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189363295 X:40369631-40369653 TTGGGGCAGGGGAGTGGGGAGGG + Intergenic
1189976418 X:46464795-46464817 TAGGGAATTGGGACTCAGGAGGG - Intronic
1190114521 X:47617890-47617912 TTGGGGAGTGGGGCTGGGGATGG + Intronic
1190260096 X:48792080-48792102 TTGGGGACAGGGAGTGATGAAGG - Exonic
1190923029 X:54875058-54875080 TTAGGGAAAGGGTCTAAGGAAGG - Intergenic
1192410433 X:70928749-70928771 ATGGGGGATGGGCCTGAGAAAGG - Intronic
1193268647 X:79504288-79504310 TTGGGAAAAGAGATTGAGGAAGG + Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1197182179 X:123548408-123548430 TTGGGGAAGAGGTCTGTGGATGG + Intergenic
1197386688 X:125811616-125811638 TTGGGGAAGAGGTCTGTGGATGG - Intergenic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198010732 X:132550977-132550999 TTAGGGAATGGGGCGGAGAAAGG + Intergenic
1198221088 X:134603196-134603218 CTGAGGAGTGGGACTGGGGATGG + Intronic
1198388358 X:136148396-136148418 TTGGCGAATGGGGGTGGGGAGGG + Intronic
1198626539 X:138582156-138582178 TGGGGGTAGGGGAGTGAGGAGGG - Intergenic
1198796655 X:140403882-140403904 TGGGGGAAAGGGTCGGAGGAGGG - Intergenic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1199503497 X:148535932-148535954 TGTGGGAATGGGAATGAGGGGGG - Intronic
1199601697 X:149544976-149544998 TAGGGGAAGGGGCTTGAGGAAGG + Intronic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199648678 X:149934507-149934529 TGGGGGAAGGGGCTTGAGGAAGG - Intronic
1199737062 X:150694130-150694152 TGGGGGGTTGGGAGTGAGGACGG + Intronic
1199863837 X:151825504-151825526 TTGGGGACTGAGATTCAGGAAGG + Intergenic
1199895115 X:152119929-152119951 TTGGGGAATGGGGGTGATGATGG + Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1200017830 X:153179680-153179702 GTGGGGAATGGGAATGCGAATGG - Intronic