ID: 1108225593

View in Genome Browser
Species Human (GRCh38)
Location 13:48285766-48285788
Sequence CTTGTAAGGTTCATGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108225590_1108225593 -10 Left 1108225590 13:48285753-48285775 CCTCCTTTAGTGGCTTGTAAGGT No data
Right 1108225593 13:48285766-48285788 CTTGTAAGGTTCATGAAGGCAGG No data
1108225587_1108225593 28 Left 1108225587 13:48285715-48285737 CCATCATAGGTTGTAATTACAAG No data
Right 1108225593 13:48285766-48285788 CTTGTAAGGTTCATGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108225593 Original CRISPR CTTGTAAGGTTCATGAAGGC AGG Intergenic