ID: 1108231450

View in Genome Browser
Species Human (GRCh38)
Location 13:48347156-48347178
Sequence TTGTATATGTTTAAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 491}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108231450 Original CRISPR TTGTATATGTTTAAGGGTGA AGG Intronic
900160615 1:1221627-1221649 TTTTAATTGTTTAAGAGTGAGGG - Intronic
900757500 1:4446730-4446752 ATGTATTGGTTTTAGGGTGAGGG - Intergenic
900904180 1:5539280-5539302 TTGTACATGTTTAAGGGATAGGG - Intergenic
900904975 1:5550273-5550295 TTGTATATGGTTATAGGTAAGGG - Intergenic
902756891 1:18554880-18554902 TTGTATATTATTAATAGTGATGG + Intergenic
904103234 1:28052179-28052201 TTTTGTATGTTTAACGGAGATGG + Intronic
904105370 1:28076910-28076932 TTGTATATTTTTAATAGAGACGG + Intronic
907017409 1:51030534-51030556 TTGTATATGGTGAAAGGTAAGGG + Intergenic
907055285 1:51360858-51360880 TTGTGGATGGTTATGGGTGATGG - Intronic
908174405 1:61540147-61540169 CTGTATATGATTCAGGGTGTTGG - Intergenic
908275332 1:62464675-62464697 TTGTTTTTGTTTAGGGGGGATGG - Intronic
908590070 1:65621780-65621802 ATGTATTGGTTTTAGGGTGAGGG + Intronic
909232454 1:73106954-73106976 TTGTATACGGTGAAAGGTGAGGG - Intergenic
909421818 1:75475744-75475766 GTATATGTGTTTAAGAGTGAGGG + Intronic
909594499 1:77390785-77390807 TTTTTTATGTTTAAAGATGAAGG + Intronic
909598556 1:77435475-77435497 TTTTATATTTTTAATGGAGATGG - Intronic
909968984 1:81957270-81957292 TTCTATATATGTAAGGCTGATGG - Intronic
910254374 1:85232723-85232745 TTGTATATGGTGAAAGGTAAGGG + Intergenic
910606467 1:89090744-89090766 TTGTATATGTCTAAAATTGATGG + Intergenic
911545096 1:99206895-99206917 TTGTATATGGTGAAAGGTAAGGG - Intergenic
911578630 1:99608619-99608641 TTGTATATGGTGAAAGGTAAGGG + Intergenic
912700774 1:111876781-111876803 ATGTATAGGCTTAAGGGAGAAGG + Intronic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913718808 1:121569531-121569553 TTGTTCATGTTTTAGGGTGCAGG + Intergenic
913964802 1:143367346-143367368 TTGTATATGCTGTAAGGTGAGGG + Intergenic
914059175 1:144192949-144192971 TTGTATATGCTGTAAGGTGAGGG + Intergenic
914119974 1:144773422-144773444 TTGTATATGCTGTAAGGTGAGGG - Intergenic
914698265 1:150106075-150106097 TTGTATATGGTTAAGAGATAGGG - Intronic
914739598 1:150452838-150452860 TTTTATATTTTTAACAGTGATGG + Intronic
914817193 1:151071640-151071662 TTGTATATTTTTAATAGAGACGG + Intronic
915244420 1:154546242-154546264 TTTTATATTTTTAATAGTGACGG + Intronic
915502804 1:156331059-156331081 TTTTATATTTTTAATAGTGACGG - Intronic
915775318 1:158478124-158478146 TTGTATATGGTGAAAAGTGAGGG - Intergenic
915933710 1:160077536-160077558 TTGTATAAATTCAAGGGGGATGG - Intergenic
915989479 1:160499232-160499254 TCGTATATGGTTAAAGGTAAGGG + Intronic
916092995 1:161323531-161323553 TTCTCTATTTTTAGGGGTGAAGG - Intronic
916907292 1:169300903-169300925 TTGTATATGGTTAATGTTAAGGG - Intronic
917134286 1:171774080-171774102 TTGTATATGGTGTAGGGTAAGGG + Intergenic
917333192 1:173903595-173903617 TTTGATATGTTTTAGTGTGATGG + Intergenic
917368050 1:174255694-174255716 TTGTATATTTTTAGTAGTGATGG + Intronic
917702741 1:177597497-177597519 TTGCATATGTTTAATGGGGGAGG - Intergenic
918031342 1:180815378-180815400 TTGTGTATGTTGTAGGGGGAGGG + Intronic
918833071 1:189423555-189423577 TTGTATTTGTTTTAGGTTAAGGG + Intergenic
919139344 1:193551018-193551040 GAGGATAGGTTTAAGGGTGAGGG - Intergenic
919243444 1:194945475-194945497 TTTTAAATGATTAATGGTGAGGG + Intergenic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
920347651 1:205317089-205317111 TTGTATATCTGTAAGTGGGATGG - Intronic
920388946 1:205586865-205586887 TTTTGTATTTTTAATGGTGATGG + Intronic
921256675 1:213347695-213347717 TTGTTTATGTTTTAGGGACAGGG - Intergenic
921691501 1:218156583-218156605 TTGTTTATGTTTTAAGGTGGGGG + Intergenic
922997032 1:229972425-229972447 TGGTATATGTGTATGGGTGTGGG - Intergenic
923121166 1:230993095-230993117 TTTTATTTTTTTAAGAGTGAAGG + Intronic
923395650 1:233559805-233559827 TTCTTTATGTTTTAGGGTAAGGG + Intergenic
923555582 1:234998110-234998132 TTGTGTATGTTTTGGGGTGGGGG + Intergenic
924381801 1:243472120-243472142 TTGTTGATGTTTCAGGGTCATGG + Intronic
924524188 1:244832221-244832243 TTTTATATTTTTAATGGAGACGG - Intergenic
924919367 1:248611637-248611659 TTGTATATTTTTATGGGGTATGG - Intergenic
1063585431 10:7348192-7348214 TGGTTTATGTTTGAGGGTGGTGG + Intronic
1064187218 10:13172800-13172822 TTGTATGTGTTTATGTGTGTGGG + Intronic
1064364296 10:14693173-14693195 TTGTATATATTTAAGGTATATGG + Intronic
1064488295 10:15820500-15820522 GTGTATATGTGTTAGGGGGAAGG + Intronic
1064654508 10:17543828-17543850 TGGTATATGCTGAAGGGAGAGGG - Intergenic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1065623843 10:27610759-27610781 TTTTATATGTTTAGTGGAGATGG - Intergenic
1066306871 10:34153768-34153790 TTATTTATGTTGAAGGGTAAGGG - Intronic
1067443024 10:46322284-46322306 TTTTATATTTTTAATGGAGATGG - Intronic
1067846611 10:49728773-49728795 TTGTATATGGTGTAAGGTGAGGG - Intergenic
1068310631 10:55270102-55270124 TTGTATATGGTAAAAGGTAAGGG - Intronic
1068352029 10:55860781-55860803 TTTTATATTTTTATGGGGGAGGG - Intergenic
1068385332 10:56318845-56318867 TTATATATAATTAAGGGAGAAGG - Intergenic
1068642722 10:59427963-59427985 TTATATTTGTTTATGGCTGAAGG + Intergenic
1068949796 10:62765558-62765580 TTGTATAAATTTAAGGGGCAAGG - Intergenic
1069081639 10:64094810-64094832 GTGGCTGTGTTTAAGGGTGAGGG + Intergenic
1069165086 10:65145789-65145811 GTGTATATGTTTATGTGTGTAGG - Intergenic
1069165336 10:65151065-65151087 TTGTATATGTTGTAAGGTAATGG - Intergenic
1069235412 10:66065350-66065372 TTGAATATATTTTAGGCTGAAGG - Intronic
1069320154 10:67159690-67159712 TTGTATATGTTGTAAGGTAAAGG - Intronic
1069597843 10:69684112-69684134 TTGTATATGTTTAGGAGAGACGG - Intergenic
1070375752 10:75829710-75829732 TTGTATATTCTTTAGGGTAAGGG + Intronic
1070663965 10:78330451-78330473 ATGTGTATGTTTAAGATTGAGGG - Intergenic
1071243263 10:83734194-83734216 TTATATATTTTTTAGTGTGAAGG - Intergenic
1071369012 10:84932086-84932108 TTGTATATGTTACAAGTTGAAGG - Intergenic
1071433827 10:85628046-85628068 GTGCATATGTGTAAGTGTGAGGG + Intronic
1071433843 10:85628303-85628325 GTGTACATGTGTAAGTGTGAGGG + Intronic
1071826783 10:89333467-89333489 TTGTATGTGTGTAAATGTGAAGG + Intronic
1072073742 10:91947379-91947401 TTGTATATGTTTTGAGGTTAAGG + Intronic
1072242539 10:93510485-93510507 ATGTATATGTGTGTGGGTGAGGG - Intronic
1072421634 10:95294696-95294718 TTGTTTATGTTTTGGGGTGAGGG - Intergenic
1072864800 10:99047290-99047312 TTGTATATGGTGAAAGGTAAGGG - Intronic
1072896712 10:99373502-99373524 TTGTAGCTGTTTTAGGGTGGTGG - Intronic
1073333803 10:102689456-102689478 TTGTAAATGTGTGAGAGTGAGGG - Intronic
1073979099 10:109133662-109133684 TTGTATCTGTTTATGTGAGATGG - Intergenic
1074330849 10:112507556-112507578 TAGTATAGGTTTGAGGGTGGAGG - Intronic
1074585493 10:114764510-114764532 TTTTGTATTTTTAAGAGTGATGG + Intergenic
1074628874 10:115226896-115226918 TTGTATATGTTGAAAGGTAGGGG - Intronic
1075907827 10:126097606-126097628 TTCTATTTGTTTAATGGAGATGG + Intronic
1076173635 10:128345792-128345814 TTGTATATGTTTAAGGAGTGAGG + Intergenic
1077104338 11:835509-835531 TTGTATATTTTTGATGGAGATGG + Intronic
1077132915 11:983188-983210 TTGTATATTTTTGATGGAGATGG + Intronic
1078189105 11:9076837-9076859 TTGTCTATGCCAAAGGGTGAAGG + Intronic
1079709588 11:23665315-23665337 TTGTATATGGTGAAAGGTAATGG + Intergenic
1079748295 11:24160899-24160921 TTTTATATGCTTAAAGGTAAGGG - Intergenic
1080000892 11:27347793-27347815 TTCTGTATCTTTAATGGTGATGG + Intronic
1080818354 11:35780719-35780741 TTTAATATGTGTAGGGGTGATGG - Intronic
1081107165 11:39084759-39084781 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1081508743 11:43746001-43746023 TTGTTTATTTTTAAGAGTCAGGG - Intronic
1082221709 11:49646857-49646879 ATGTATTGGTTTTAGGGTGAGGG + Intergenic
1082886052 11:58083631-58083653 TTGTATATGCTGAAAGGTAAGGG + Intronic
1086196738 11:84149389-84149411 TTGTATATGATAAAAGGTAAGGG + Intronic
1086627321 11:88972302-88972324 ATGTATTGGTTTTAGGGTGAGGG - Intronic
1086996160 11:93358751-93358773 TTGTATATTTTTAATAGAGATGG + Intronic
1087260075 11:96001525-96001547 TTGTATATGTGTTTGGGGGATGG - Intronic
1087317237 11:96616715-96616737 TTGTATGTGTTGGGGGGTGAGGG - Intergenic
1087439804 11:98169007-98169029 TTGTGTATGGTGAAGGGTGGGGG - Intergenic
1087797058 11:102465499-102465521 ATGTATATGTTTCATTGTGATGG + Intronic
1088406149 11:109480920-109480942 TTTTATATGTTTGAGAGTAAGGG + Intergenic
1089674241 11:120079413-120079435 CTGTAAATGTTGAAGGGGGAAGG + Intergenic
1090790250 11:130086694-130086716 TTGTATATGGTTTAAGGTAAGGG + Intronic
1091194996 11:133723233-133723255 TTGTGTATGTTTATGGGTTTTGG - Intergenic
1091742690 12:2971304-2971326 GTGTATATGTGTAAGAGAGAGGG + Intronic
1092497165 12:9008205-9008227 ATTTATATATTTAAGGATGATGG + Intronic
1092674843 12:10904496-10904518 TTGTATATGGTGAAAGGTAAAGG - Intronic
1092751182 12:11720547-11720569 TTGTATATGGTGAAAGGTAAGGG - Intronic
1093877315 12:24364448-24364470 ATGGATATTTTTAAGGGTGTAGG - Intergenic
1094425974 12:30317413-30317435 TTGTATACGTATAAGAGTGTGGG - Intergenic
1096679377 12:53244944-53244966 TTGTGTATTTTTAATAGTGATGG - Intergenic
1096932664 12:55231028-55231050 TGGTTTATATTTAAGTGTGAGGG - Intergenic
1097945283 12:65360925-65360947 TTGGAAATGTTTAAGAGGGAAGG - Intronic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1098690582 12:73482391-73482413 TTTTATATGTTTAATAGAGATGG + Intergenic
1098988247 12:77035778-77035800 TAGTATATGTTTTAGTGTGCTGG - Intronic
1099017126 12:77357567-77357589 TTGTAAATGTTTATAGTTGAGGG - Intergenic
1099059006 12:77882399-77882421 TTGTATATGGTGAAAGGTAAAGG - Intronic
1099612861 12:84897018-84897040 TTGTATTTTTTTAGGGGAGAGGG - Intronic
1099770445 12:87046252-87046274 TTTTAGATCTTTAGGGGTGAGGG - Intergenic
1099849722 12:88076913-88076935 TTGAATATGTTAAGGTGTGAAGG + Intronic
1100847211 12:98672333-98672355 TTTTATATTTTTAATGGAGATGG + Intronic
1100888023 12:99093882-99093904 GTGTTTATTCTTAAGGGTGAAGG + Intronic
1100948947 12:99823760-99823782 TTGTATATGGTGAAAGGTTAAGG + Intronic
1101167928 12:102058230-102058252 TTTTATATGGTAAAGGATGAGGG - Intronic
1104914079 12:132255744-132255766 ATGTGTATGTTTTAGGGAGAAGG - Intronic
1105343292 13:19548680-19548702 TTGTATATGGTCAAAGGTGGGGG - Intergenic
1105537018 13:21275416-21275438 TTGTATATGGTCAAAGGTGGGGG + Intergenic
1107233556 13:38140348-38140370 TTTTATATGTTGAAGGGTATGGG + Intergenic
1107345846 13:39459814-39459836 TTGTTTATGTTTCAGGTTGCTGG - Intronic
1107601380 13:42016460-42016482 TTGTTTGTGTTTAAGGCAGAAGG - Intergenic
1108231450 13:48347156-48347178 TTGTATATGTTTAAGGGTGAAGG + Intronic
1108299515 13:49060471-49060493 TTTTATATTTTTAATGGAGATGG - Intronic
1108629074 13:52263108-52263130 ATGGATATGTTTCAGGGTAATGG - Intergenic
1108656981 13:52543368-52543390 ATGGATATGTTTCAGGGTAATGG + Intergenic
1109078729 13:57870576-57870598 TTGTATATGGTGAAAGGTCAGGG - Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1110941064 13:81349013-81349035 TTATATATGTTTGGGGATGAGGG + Intergenic
1111340421 13:86878526-86878548 TTTTATATTTTTAATGGAGACGG + Intergenic
1111490417 13:88965884-88965906 TTGAATATATTTCAGGGGGATGG + Intergenic
1112371690 13:98799670-98799692 TTGTATATGTTATAGTGTAAGGG - Intronic
1112965155 13:105181542-105181564 TTTTAGATTTTTAAAGGTGAAGG + Intergenic
1112985231 13:105440931-105440953 TTGTATATTTTTTAGAGAGAAGG + Intergenic
1114299084 14:21358155-21358177 TTGAAAATGTTTAAGGGTTTAGG - Intronic
1114759431 14:25296769-25296791 TTTTATATTTTTAATGGAGATGG - Intergenic
1114931809 14:27479730-27479752 TTGTATATATTTATAGGTGCAGG + Intergenic
1114963701 14:27928802-27928824 TTCTAAATGTTTAAGGTTAAGGG + Intergenic
1115084252 14:29494383-29494405 ATGTATGTCTTTAAAGGTGAAGG + Intergenic
1115196845 14:30810263-30810285 TGGTATATGTTTGAGTGTGGTGG - Intergenic
1115629461 14:35229466-35229488 TTGTATATGGTGAAAGGTAAAGG + Intronic
1116026267 14:39519193-39519215 TTGTATATGGTGAAAGGTAAAGG - Intergenic
1116292178 14:43057994-43058016 TTGTATATGGTAAAAGGTTAAGG + Intergenic
1116465308 14:45224922-45224944 TAGTATATGTTTACAGTTGAAGG - Intronic
1116482621 14:45410024-45410046 TTGTATATGATGAAAGGTAAGGG + Intergenic
1116625799 14:47261703-47261725 TTGCATATGTTTAAGTGTCTGGG + Intronic
1117291182 14:54334890-54334912 TTTAATATGTGTTAGGGTGAAGG - Intergenic
1118180748 14:63490249-63490271 TTGTATATGGTGAAAGGTGTAGG - Intronic
1118452325 14:65914841-65914863 TTGTATATGGTTAGAGGTAAGGG - Intergenic
1118861754 14:69669618-69669640 TTGAAGATGTTTAGGGGAGAAGG - Intronic
1119720512 14:76886846-76886868 TTGCTTCTGTTGAAGGGTGATGG - Intergenic
1120362040 14:83516324-83516346 TTTTATATTTTTAATGGAGACGG + Intergenic
1121096011 14:91218571-91218593 TTTTGTATTTTTAATGGTGACGG + Intronic
1121774204 14:96579617-96579639 ATGGGAATGTTTAAGGGTGATGG + Intergenic
1123162851 14:106296517-106296539 TTGTATAAATTTAAGGGCTATGG + Intergenic
1125324676 15:38524776-38524798 TTGAATGTGTTTTAGGCTGAGGG + Intronic
1127405939 15:58646405-58646427 TTGAAAATGTTTAAAAGTGAAGG - Intronic
1128024540 15:64424016-64424038 TTCTATTTGTTTAAGGGTGGAGG + Exonic
1129562961 15:76591162-76591184 TTGTATAAATTTAAGGGTTGAGG - Intronic
1130305028 15:82707773-82707795 TTGTATAGGATTATTGGTGATGG - Intronic
1130882176 15:88064818-88064840 TTGCATGTGGGTAAGGGTGAAGG - Intronic
1133422808 16:5661567-5661589 TTGTATATGTTTAAGGTATACGG + Intergenic
1133624609 16:7559468-7559490 TTTTATATTTTTAAGGCAGATGG - Intronic
1135474333 16:22761088-22761110 TTGTATTTTTTTAATGCTGATGG - Intergenic
1136772457 16:32853241-32853263 TTGTATAAATTTAAGGGCTATGG - Intergenic
1136898158 16:34008276-34008298 TTGTATAAATTTAAGGGCTATGG + Intergenic
1137998645 16:53249338-53249360 TTGTATATGTTAAATGGGGAAGG + Intronic
1138057599 16:53851935-53851957 ATATATATGTTTAAGGGTTAGGG - Intronic
1140579501 16:76212709-76212731 TTGTATATGATAAATGGTAAGGG - Intergenic
1140647923 16:77053261-77053283 TTGTGTATGTTTATGTGTGTTGG + Intergenic
1203074879 16_KI270728v1_random:1115339-1115361 TTGTATAAATTTAAGGGCTATGG - Intergenic
1143952139 17:10641684-10641706 TTTCATATGTTTAATGGAGACGG + Intronic
1144087813 17:11826632-11826654 TTTTGTATGTTTAATGGAGACGG + Intronic
1144336339 17:14272639-14272661 TTGTATATGATGTAGGGTAAGGG + Intergenic
1145886630 17:28386374-28386396 TTCTATATCTTTAATGATGATGG - Intronic
1145914877 17:28566762-28566784 TTGTGTATGTTTAGTGGAGAAGG + Intronic
1146395994 17:32467414-32467436 TTGTATATTTTTAATAGAGACGG + Intronic
1149112629 17:53051251-53051273 TTGTATATGATGAAAGGTAATGG - Intergenic
1149794400 17:59506112-59506134 TTGTACAGGGTTGAGGGTGAGGG - Intergenic
1150814697 17:68383859-68383881 CTGTTTATGTTTAAGGGTGTGGG - Intronic
1150885049 17:69075416-69075438 TTGTATATGGTGAAAGGTGGGGG + Intergenic
1151061996 17:71105720-71105742 TTGTATATGGTAAAGGGTATGGG - Intergenic
1151271212 17:72997421-72997443 TTTTATATTTTTAATGGAGATGG + Intronic
1152557645 17:81062119-81062141 TTGTATATTTTTAGTGGAGATGG + Intronic
1154323336 18:13371590-13371612 TTTTGTATTTTTAAGGGAGATGG - Intronic
1155607455 18:27623707-27623729 TTGTATATGTTGTAAGGTAAGGG - Intergenic
1156380716 18:36558408-36558430 TTTTATATGTTTCAGGCAGAAGG + Intronic
1157765571 18:50294431-50294453 TTGTATATTTTTAGTGGAGATGG + Intergenic
1158127004 18:54111423-54111445 TTGTATATGGTTAAAGGAGGGGG + Intergenic
1158298178 18:56022314-56022336 TTGTATATTATTGAGGGTGGTGG - Intergenic
1158702081 18:59757241-59757263 TTGTATATATTTAGGGGTATAGG + Intergenic
1158901590 18:61966916-61966938 TTGTATATTTTTAATAGAGAGGG + Intergenic
1159320694 18:66844049-66844071 TCGTATATGGTGAAGGGTAAAGG - Intergenic
1159827403 18:73230890-73230912 TAGTATATGTTTAATGTAGAAGG - Intronic
1164672422 19:30080251-30080273 TTTTATATTTTTAATGGAGATGG + Intergenic
1165291883 19:34892225-34892247 GTATATATGTTAAAGGGTGTGGG + Intergenic
1165683521 19:37797998-37798020 TTGTATATGGTGAAAGGTAAGGG + Intronic
1166287027 19:41837521-41837543 TTTTGTATTTTTAAGGGAGATGG - Intronic
1166430590 19:42723342-42723364 TTTTATATCTATATGGGTGAAGG + Intronic
1168441888 19:56375563-56375585 TTTTATATGTTTTGTGGTGATGG + Intergenic
1202698578 1_KI270712v1_random:144836-144858 TTGTATATGCTGTAAGGTGAGGG + Intergenic
926554804 2:14344278-14344300 TTGTATATATTTAAGGTATACGG - Intergenic
926621783 2:15053010-15053032 TTGTATTTTTTAAAGGATGATGG + Intergenic
927354987 2:22162570-22162592 TGGTACATGTTTTAGGGGGATGG + Intergenic
928046430 2:27937978-27938000 TTGTATATGATGAAAGGTAAGGG + Intronic
928567807 2:32570802-32570824 TTGTTTATTTTTAAGGGTTGAGG + Intronic
928884204 2:36129817-36129839 ATGTATATGTATAAATGTGATGG + Intergenic
929073280 2:38055987-38056009 TTGTGTGTGTGTCAGGGTGAGGG - Intronic
929113940 2:38428667-38428689 TTTTATATTTTTAATGGAGACGG + Intergenic
930657996 2:54025944-54025966 TTTTATATTTTTAATGGAGATGG - Intronic
931870431 2:66452291-66452313 ATTTATATGTTCAAGAGTGAAGG - Intronic
933167837 2:79095090-79095112 TTTTAGGTTTTTAAGGGTGAGGG + Intergenic
934279825 2:91602617-91602639 TTGTATATGCTGTAAGGTGAGGG + Intergenic
936405892 2:112202071-112202093 TTGTATATATTTAAGACTTATGG + Intergenic
936465710 2:112747493-112747515 GTGTATATGTGTAAGTGTCAGGG + Intronic
937570293 2:123349822-123349844 TGGTATATCTTTGATGGTGATGG + Intergenic
938035961 2:128035150-128035172 TTGTATATGTTTTAGGGAGACGG + Intergenic
938315683 2:130326310-130326332 TTGTATATTTTTAGTGGAGATGG + Intergenic
939583758 2:143982688-143982710 TTTTATATTTTTAGAGGTGAGGG - Intronic
939801724 2:146719931-146719953 TTATTTATTTTTAATGGTGATGG - Intergenic
939875658 2:147574481-147574503 TGGTATATGTGTGAGAGTGAGGG - Intergenic
939951130 2:148474645-148474667 ATGTATATCTTTAAGAGTTAAGG - Intronic
939993661 2:148900250-148900272 TGATATGTGTTTAAGGATGAAGG - Intronic
940019646 2:149143542-149143564 TTGTCATTGTTTTAGGGTGATGG - Intronic
940520979 2:154747753-154747775 TTCTATAAGTTTTAGGCTGAAGG - Intronic
940982352 2:160017819-160017841 TTGTATTTTTCTAAGGGTCATGG - Intronic
941338757 2:164279036-164279058 TTGTATATGTTGAGAGGTGAAGG + Intergenic
942215471 2:173715074-173715096 GTGTATATGTTTAGGAGTGGAGG + Intergenic
943151713 2:184122197-184122219 TTGGAGATGTTTAAGGATGATGG - Intergenic
943184810 2:184594489-184594511 TTGTATTATTTTATGGGTGATGG - Intergenic
943489543 2:188533448-188533470 TTGTATATGGTGAAAGGTAAGGG - Intronic
945339435 2:208634270-208634292 TTGTATATGTTGAAATGTAAGGG + Intronic
945729610 2:213517772-213517794 TTGTATATGGTAAAAGGTAAGGG - Intronic
948450927 2:238071000-238071022 TTTTATATTTTTAAGAGAGATGG + Intronic
1168907827 20:1420734-1420756 TTGTATATGGTGAAAGGTAATGG + Intergenic
1170135058 20:13063823-13063845 TTGTGTATGTTTAGTGGAGATGG + Intronic
1170222227 20:13952856-13952878 TTTTATATGTTTAATAGAGATGG - Intronic
1172088922 20:32413180-32413202 TTGTTGTTGTTTAAGGATGAAGG + Intronic
1172221010 20:33275069-33275091 TTTTATATTTTTAATGGAGACGG - Intronic
1172655571 20:36535132-36535154 TTGTATATGTTGCAAGGTAAGGG - Intergenic
1173830911 20:46087585-46087607 TTGTATATTTTTAGTGGAGACGG - Intronic
1174249619 20:49208792-49208814 TTGTATTTTTTTAATGGAGACGG + Intergenic
1174660512 20:52208934-52208956 TTGTCAGGGTTTAAGGGTGAAGG + Intergenic
1175932766 20:62500617-62500639 GTGTATATGTGTGAGTGTGAGGG + Intergenic
1176174420 20:63712176-63712198 TTGTATATGTTATTAGGTGAGGG + Intronic
1178026261 21:28471704-28471726 TTGTATATGGTGAATGGTAAGGG - Intergenic
1178494756 21:33077287-33077309 ATGTATGTGTTGAAGGGTGCGGG - Intergenic
1178727179 21:35064170-35064192 TTGTATATATTAATAGGTGAAGG - Intronic
1178730328 21:35096170-35096192 ATGCTTATGTTGAAGGGTGAGGG - Intronic
1178742819 21:35218723-35218745 TTGTATACTTTGAAGGGGGATGG - Intronic
1178831879 21:36063125-36063147 ATGTATTGGTTTTAGGGTGAGGG - Intronic
1179378019 21:40869038-40869060 TTGTATATGGTGAAAGGTAAGGG - Intergenic
1179803527 21:43823391-43823413 TTTTGTATGTTTAATGGAGACGG - Intergenic
1180254351 21:46613805-46613827 TTGTATTTGTTTAATAGAGATGG + Intergenic
1181595139 22:23909226-23909248 TTGGATATGGCTAAGGGAGAAGG + Intergenic
1182774506 22:32820728-32820750 TGGGATATGTTTTAGGGTGAAGG + Intronic
1183277635 22:36910160-36910182 TTGTATATGGTGAAAGGTAAGGG + Intergenic
949367186 3:3295321-3295343 TTGTATATGGTGAAAGGTAATGG - Intergenic
949745550 3:7288160-7288182 TTGTATATCCTTAAAGGAGAAGG - Intronic
949777836 3:7652185-7652207 TGGTACATGTTTGAGAGTGAAGG + Intronic
951269824 3:20610135-20610157 TTGTATATGGTGAATGGTAAAGG - Intergenic
951597134 3:24330487-24330509 TTTTATTTCTTTTAGGGTGATGG - Intronic
953595733 3:44311185-44311207 TTGTATATGTTCAGTGCTGAGGG + Intronic
953953112 3:47207974-47207996 TTGTATATTTTTAGTAGTGACGG + Intergenic
954867793 3:53744385-53744407 TTGTTTTTGTTTAAGGTTGGAGG - Intronic
955080394 3:55652699-55652721 TTTTATATTTTTAAGAGAGATGG - Intronic
955578708 3:60395442-60395464 TAGTAAATGATTAAGAGTGAAGG - Intronic
955786877 3:62550406-62550428 TTGTTTGTGTTTAAAGATGAGGG - Intronic
956010162 3:64822000-64822022 TTGCATATGTTTAAGATTTAAGG + Intergenic
957592647 3:82220446-82220468 TTGTATATGGTGAAAGGTAAGGG + Intergenic
958754295 3:98232211-98232233 TTGTATATGTTGAAAGGTAAGGG - Intergenic
959047219 3:101487633-101487655 TTGTATATGGTAAAAGGTAAGGG + Intronic
959974348 3:112441527-112441549 TTGTATATGGTGAAAGGTAAGGG - Intergenic
960383217 3:116989899-116989921 TTATATATGTTCAAGAGTCACGG + Intronic
960683914 3:120278144-120278166 TTGTATATGGTGAAAGGTAAGGG - Intronic
960775008 3:121240233-121240255 ATCTATATTTTTAAGGGAGATGG + Intronic
960775638 3:121248817-121248839 TTGTATATGGTGAAAGGTAAGGG + Intronic
961253935 3:125530573-125530595 TTTTATTTGTTTCAGGGAGATGG - Exonic
961379294 3:126486889-126486911 ATGTACATGTGTAAGTGTGATGG + Intronic
961908852 3:130293322-130293344 CTGTACATTTTTAGGGGTGAGGG - Intergenic
962657163 3:137558981-137559003 TTGTATATGGTGAAAGGTAAGGG - Intergenic
964721609 3:159772520-159772542 TAATATGTGTTTAAGGGGGAGGG - Intronic
964754771 3:160083266-160083288 TTTTCTAAGTTCAAGGGTGAAGG - Intergenic
964883666 3:161454026-161454048 TTGTACATATTTATGGGGGATGG + Intergenic
965252915 3:166365688-166365710 TTGTTTATTTTTGAGGGTGGTGG + Intergenic
965340683 3:167487347-167487369 TTGTATATGTTGAAAGATAAGGG - Intronic
965409140 3:168307564-168307586 TTGGAGATGTTGGAGGGTGAGGG - Intergenic
965475183 3:169147596-169147618 ATCTACATGTTTAAGGGGGATGG - Intronic
965849584 3:173007880-173007902 TTGTAAAAGCTTAAGGGTAAAGG - Intronic
966555033 3:181249487-181249509 TTTTATATTTTTAGGGGAGACGG + Intergenic
966695649 3:182787968-182787990 TTGTATACGTTTTTGGGTTAAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967687437 3:192434055-192434077 TTTTCTCTGTTTAAGGGTGGTGG - Intronic
968918323 4:3508174-3508196 TTTTATATTTTTAATGGAGACGG + Exonic
969030933 4:4213221-4213243 TTGTATATGGTGTAAGGTGAGGG - Intronic
969153490 4:5190233-5190255 TTGTATATGTTGGTGGGTAATGG + Intronic
970875705 4:20867493-20867515 TAGTATATGTTGAAAGGTGGGGG - Intronic
971526223 4:27621826-27621848 TTGTATATGGTGAAAGGTGGGGG - Intergenic
971696602 4:29912350-29912372 TTGTATATGGTGAAAGGAGAGGG - Intergenic
972267865 4:37480577-37480599 ATATATTTGTTTTAGGGTGAGGG + Intronic
972467965 4:39376070-39376092 TGGTATATTTTTAAGGGTGGAGG + Intergenic
973034358 4:45387583-45387605 TTGTATATCTGTGAGGTTGATGG + Intergenic
973143076 4:46793125-46793147 ATATATTTGTTTAAGGGTGAGGG + Intronic
974763965 4:66316227-66316249 TTTAATATGTTTAGGGGTGTGGG + Intergenic
975481131 4:74881704-74881726 TTGAATATACTTAAGGCTGAAGG + Intergenic
975563963 4:75734308-75734330 TTGTATATGGTAAAAGGTAAGGG + Intronic
976364704 4:84220504-84220526 TTGTTTTTGTTAAAGGGTAAAGG - Intergenic
976627232 4:87199301-87199323 TTGTATATGGTGTAAGGTGAGGG - Intronic
977037240 4:91970089-91970111 TTGTATATGTTTAAAGATAGGGG + Intergenic
978685923 4:111443347-111443369 TTGTATATGGTGAAAGGTAAGGG + Intergenic
979207074 4:118051189-118051211 TTGTATATGGTAAAAGGTAAGGG - Intronic
979384005 4:120042443-120042465 TTGTATATGTTTTGTGGAGACGG - Intergenic
979429039 4:120604428-120604450 TTGTATATGGTGAAAGGTGTGGG - Intergenic
979942106 4:126774246-126774268 TTGTATATATTTAAGGTATACGG + Intergenic
980220991 4:129914983-129915005 TTGTATATATGTAAGAGGGAGGG - Intergenic
980528546 4:134020495-134020517 TTCTAGATGTTTAAGGTTAAGGG - Intergenic
981054659 4:140348023-140348045 TTGTATATGTTTATGGTTTATGG + Intronic
982377157 4:154705411-154705433 TTGTATGTGTGTAGGGTTGAGGG + Intronic
982564898 4:156973568-156973590 TTGTAAATTTGTGAGGGTGAAGG + Intergenic
983097660 4:163583414-163583436 TTATATATGTATAGGGGTGTTGG - Intronic
983174662 4:164574197-164574219 TTGTATATGGTGAAAGGTAAGGG - Intergenic
983423608 4:167553231-167553253 TTGTATATGTGGTAGTGTGATGG + Intergenic
983522762 4:168727881-168727903 TTGTATATGGTGAAAGGTAAGGG + Intronic
984768576 4:183418790-183418812 TTATTTATTTTGAAGGGTGAGGG - Intergenic
984905880 4:184625471-184625493 TTGAATAGGTTTAATGCTGATGG - Intergenic
984962222 4:185108981-185109003 TTTTATACATTTTAGGGTGACGG + Intergenic
985934794 5:3088944-3088966 TTGTAAACATTTAAGGATGAAGG - Intergenic
986228544 5:5840093-5840115 TTCTATAATTTAAAGGGTGAAGG - Intergenic
986444070 5:7806092-7806114 TTGTAGATTTTTAATGGTTAGGG + Intronic
986689618 5:10303465-10303487 TTATATCTGTTGAAGAGTGATGG - Intronic
989459329 5:41679069-41679091 TTGTATATGGTGAAAGGTAAGGG + Intergenic
989959790 5:50398513-50398535 TTGTTTATGTTTTAGGGTGCAGG - Exonic
990119128 5:52427596-52427618 TGATAAATGTTTAAGGTTGATGG + Intergenic
990195002 5:53304978-53305000 TTGTATTTGTATAAGTGTTACGG - Intergenic
990231157 5:53714329-53714351 TTGTATATGATTAAAGGTAGGGG - Intergenic
990642328 5:57800867-57800889 TTGTATATGTTGAGAGGTAAGGG + Intergenic
990714475 5:58621744-58621766 TTTTATATTTTTAGGGGAGATGG + Intronic
990717458 5:58653943-58653965 TTGTATATTCTTAAGGCTGCTGG - Intronic
991118981 5:62988970-62988992 TTGTATATGGTAAAAGGTAAGGG - Intergenic
991213630 5:64135403-64135425 TTGTATATGTATATGTGTGTAGG - Intergenic
992460526 5:76955480-76955502 TTGTATATATTGGATGGTGAGGG - Intronic
992820442 5:80490570-80490592 TTGTGGATGTTAAAGGGTGGGGG - Intronic
993973359 5:94446704-94446726 TTGTACATATTTAAGGATAACGG + Intronic
994111497 5:96009965-96009987 TTGTATATGGTGAAAGGTAAGGG + Intergenic
995635688 5:114187676-114187698 TTTTATATTTTTAGGGGAGATGG + Intergenic
995813604 5:116139770-116139792 TTGTATATATTTAAGGTATACGG + Intronic
995950695 5:117709355-117709377 TTTTATATTTTTAAGAGAGACGG + Intergenic
996875691 5:128238254-128238276 TTGTATATGTTAAAGGATGTGGG + Intergenic
997199507 5:132001291-132001313 TTGTACATGTGTGATGGTGAAGG - Intronic
998787791 5:145730982-145731004 ATGTATTAGTTTTAGGGTGAGGG - Intronic
998803901 5:145899730-145899752 TTGTATATGGTAAAAGGTAAAGG - Intergenic
999114069 5:149146487-149146509 TTGTATATGGTGAAAGGTAAGGG + Intronic
999674531 5:153985742-153985764 TTGTATTTCTTTAAGGGGAAAGG - Intergenic
999999953 5:157128369-157128391 TTGTATAGGGTTATAGGTGAGGG - Intronic
1000520451 5:162288523-162288545 TTGTATATGTGTAAAGTTTAGGG + Intergenic
1000823032 5:166008983-166009005 TTGTATATGGTTAAAGGTAGGGG + Intergenic
1001349406 5:170943762-170943784 TTGTATATATTTAAGGTGTACGG + Intronic
1001366520 5:171146572-171146594 TTGTATATTTTTCTGGGAGAGGG + Intronic
1002562876 5:180094184-180094206 TTGAAGGTGTGTAAGGGTGAAGG + Intergenic
1002953489 6:1839540-1839562 TGGTAAATATTTAAGGGTCAGGG - Intronic
1003276052 6:4654009-4654031 TTTTATATTTTTAATGGAGATGG - Intergenic
1003658873 6:8041816-8041838 TTGTATATATTTAATAGAGACGG + Intronic
1003792083 6:9557492-9557514 TTTTATATTTTTAATGGAGACGG - Intergenic
1004435660 6:15590567-15590589 TTTTATATTTTTAATGGGGAAGG - Intronic
1005421197 6:25652787-25652809 TTGTATATGTTCAAGGCTTGTGG + Intronic
1006672873 6:35740554-35740576 TTGTATATGTGTAAGTTAGAAGG + Intronic
1008372840 6:50755128-50755150 TTGTTTATGTTGCAAGGTGAGGG + Intronic
1009323394 6:62318925-62318947 TTAAATTTGTTTAAAGGTGATGG - Intergenic
1009547308 6:65036299-65036321 TTGTATATGGTGAAAGGTAAGGG - Intronic
1009549954 6:65077330-65077352 TTGTCTCTCTTTAATGGTGATGG - Intronic
1009949232 6:70376361-70376383 TTGTATATGTTGAATGGAGTAGG - Intergenic
1010531261 6:76970177-76970199 TTGTATATTTTGAAGGGGAATGG - Intergenic
1010647078 6:78402362-78402384 TTGTATATGTTAAAAGGAAAAGG + Intergenic
1011890488 6:92153221-92153243 TTGTATATGTGTATTGGTCAGGG + Intergenic
1012537995 6:100322786-100322808 TTGTATATTTTTTATGGAGATGG + Intergenic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1013643331 6:112110017-112110039 ATGTAGAGGCTTAAGGGTGAAGG - Intronic
1014672556 6:124323961-124323983 TTTTGTATTTTTAATGGTGACGG + Intronic
1014872756 6:126615859-126615881 TTGTATATGATGAAAGGTAAGGG - Intergenic
1015407035 6:132849424-132849446 CAGTATATGTTAAAGGTTGAAGG - Intergenic
1019834870 7:3372806-3372828 TTGCAAATGTGTAAAGGTGATGG + Intronic
1020490024 7:8770501-8770523 ATGAATATGCTTTAGGGTGATGG - Intergenic
1020841856 7:13227740-13227762 CTGTATATGGTAAAGTGTGATGG + Intergenic
1020930721 7:14389929-14389951 TTGTTAAAGTTAAAGGGTGAGGG + Intronic
1021645986 7:22789882-22789904 TTGTTTGTTTTTGAGGGTGAAGG + Intergenic
1022256749 7:28665921-28665943 TGGGATATTTTTAAGGGTGTCGG - Intronic
1022416724 7:30184741-30184763 TTGTAAATGAATGAGGGTGACGG - Intergenic
1023239539 7:38128950-38128972 TTTTGTATTTTTAAGGGAGATGG - Intergenic
1023268783 7:38436958-38436980 TTGTGTATGTGTATGAGTGAGGG + Intronic
1023333622 7:39145737-39145759 TTGTACAGTTTTAAGGGTGTGGG + Intronic
1023394589 7:39741141-39741163 TTTTATATTTTTAAAGATGAGGG + Intergenic
1023792813 7:43766992-43767014 TTGTTTATTTTTCAGGGTCAGGG - Intronic
1024614457 7:51098581-51098603 TTTTATATGGTTAACGGTAAGGG - Intronic
1025890212 7:65642765-65642787 TTGTTTATGTCTAAGGGAGGGGG - Intergenic
1027528680 7:79302524-79302546 GTGTATATATTTAAAGTTGATGG + Intronic
1027641089 7:80734645-80734667 TTGTATATGGTAAAAGGTAAGGG - Intergenic
1027705119 7:81521414-81521436 TTGTATAAATTTAAAAGTGATGG - Intergenic
1028961432 7:96753700-96753722 ATGTATATATTTAGGGGTGAGGG + Intergenic
1029298797 7:99562204-99562226 TATTAGATGTTTAAGGGTTATGG + Intronic
1030299089 7:107957217-107957239 TTTTGTATTTTTAAGGGAGATGG - Intronic
1030473100 7:109992696-109992718 TTCTATATGGTGAAAGGTGAAGG + Intergenic
1030531185 7:110713081-110713103 TTGTATATGGTGAAAGGTAAGGG + Intronic
1030959538 7:115899565-115899587 TTGTATATGGTGAAAGGTAAGGG - Intergenic
1031128411 7:117802314-117802336 TTGTATATGTTGAAAGGTGTGGG - Intronic
1032284664 7:130531263-130531285 TTATATATGTTCAGGGTTGAGGG + Intronic
1032437998 7:131917793-131917815 TTTTATATTTTTCAGTGTGAAGG - Intergenic
1033460551 7:141543354-141543376 TTGTATTTTTTTAATAGTGATGG + Intergenic
1033937745 7:146608710-146608732 TTGTATATTTTTAAGGCTTTTGG + Intronic
1034539788 7:151749924-151749946 TTTTATATGTTTAGTGGAGATGG - Intronic
1034615075 7:152409177-152409199 TTGTATTTTTTTTAGGGTCAGGG + Intronic
1034986751 7:155520954-155520976 TTTTATATTTTTAATGGAGATGG - Intronic
1036048654 8:5171430-5171452 TTGCAAATGTTTAAGGTTCATGG + Intergenic
1036052569 8:5216811-5216833 ATGCATATGTTTAAGGGTACTGG + Intergenic
1038703150 8:29870076-29870098 TTGGGTATCTTGAAGGGTGAAGG + Intergenic
1038724971 8:30073600-30073622 TTTTATATACTTGAGGGTGAGGG - Intronic
1038817432 8:30919449-30919471 TGGAATATGTTAAAGGGTAATGG - Intergenic
1039296728 8:36164405-36164427 TTGTATATTTTTAATAGAGATGG - Intergenic
1039559666 8:38503000-38503022 GTGTATATGTGTGAGGGTGAGGG + Intergenic
1040052087 8:43025597-43025619 TTGTATATGTTTACTAGTAAAGG + Exonic
1040506720 8:48055724-48055746 TTGTTTAGGTCTAAGGGAGATGG - Intronic
1041264569 8:56051779-56051801 TTGTGTATTTTTAATGGAGACGG - Intergenic
1042432404 8:68723695-68723717 TGGTATATGTTTAGGCCTGAGGG - Intronic
1043088338 8:75865981-75866003 TTTTGTAAGTTTAAGGGTTAGGG - Intergenic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043610671 8:82059133-82059155 TTGTATATGATGAAAGGTGGAGG + Intergenic
1043788994 8:84438755-84438777 TTGTATATGCTAAAAGGTAATGG + Intronic
1043959297 8:86397346-86397368 TTGTATATATTTATGGGGTATGG + Intronic
1044342579 8:91064258-91064280 TTGTATAATTTTAAGGCTGAAGG + Intergenic
1046012607 8:108568729-108568751 TTGCATGTGTGTGAGGGTGAAGG + Intergenic
1046531266 8:115448762-115448784 TTATAGTTGTTTAATGGTGATGG - Intronic
1046889560 8:119407385-119407407 TTGTATATGGTCAAAGGTAAGGG - Intergenic
1047147356 8:122218260-122218282 TTGTATATGGTTAAAGGTAAGGG - Intergenic
1047193143 8:122696735-122696757 TTGGATATGTTCATGAGTGATGG - Intergenic
1047575363 8:126148442-126148464 TTATTAATGTTTAAAGGTGATGG - Intergenic
1047834713 8:128675953-128675975 TTGTATATGGTGAAAGGTAAAGG + Intergenic
1047951233 8:129937005-129937027 TTGTATATTTTTAAGACTGCTGG - Intronic
1048017565 8:130511279-130511301 TTCCATTTGTTTAAGGGTGGGGG + Intergenic
1048719541 8:137308055-137308077 TTGTATATTTTTAGTAGTGATGG - Intergenic
1048746320 8:137618213-137618235 TTTTGTATTTTTAAGGGAGATGG - Intergenic
1050269360 9:3925688-3925710 TTGTTTAAGTTCAAGGTTGAGGG - Intronic
1050548085 9:6726097-6726119 TTTTATATATTTAATGGAGATGG + Intronic
1050625263 9:7497084-7497106 ATGTATGTGTTTATAGGTGAAGG + Intergenic
1050648193 9:7745002-7745024 TTGTATATGATTAAAGGTAGAGG + Intergenic
1051973199 9:22915915-22915937 TTGTATATGATAAAAGGTGTAGG - Intergenic
1052005673 9:23345584-23345606 TTGTGTATGGTGAAGGGTAAGGG - Intergenic
1052361492 9:27565467-27565489 ATGTATCTGTATAAGGTTGATGG - Intronic
1053194477 9:36105767-36105789 ATATATAACTTTAAGGGTGAAGG + Intronic
1053826997 9:42035568-42035590 TAGTATATATTTCAGAGTGATGG + Intronic
1054603563 9:67151864-67151886 TAGTATATATTTCAGAGTGATGG - Intergenic
1055077218 9:72228715-72228737 TTTTATATGTTTAATACTGATGG - Intronic
1056525349 9:87438399-87438421 TTTTATATTTTTAAGAGAGACGG - Intergenic
1057341063 9:94201836-94201858 TTTTATATTTTTAAGAGAGACGG - Intergenic
1057920109 9:99090355-99090377 TGGTAGATCATTAAGGGTGAGGG - Intergenic
1058102631 9:100934263-100934285 TTGTATATGGTGAAAGGTGGGGG + Intergenic
1058641528 9:107090658-107090680 TTATATATCTTTAAGGGGTATGG - Intergenic
1059680972 9:116585636-116585658 TTGTATATGGTGAAAGGTAAGGG - Intronic
1061078627 9:128356631-128356653 TTTTATATGTTTAGTGGAGACGG - Intronic
1185548833 X:967600-967622 TTTTATATTTTTAGTGGTGAGGG - Intergenic
1186778096 X:12885720-12885742 TGGTATGTGGTTAATGGTGAGGG - Exonic
1187325604 X:18284234-18284256 TTGTATATGGTGAAAGGTAAGGG - Intronic
1187375830 X:18753315-18753337 TTTTATTTCTTTAAGGTTGATGG + Intronic
1188091786 X:25973624-25973646 TTGTATATGGTGAAAGGTAATGG - Intergenic
1189019331 X:37318261-37318283 TTTTTTATGTTTAATAGTGATGG + Intergenic
1189059239 X:37735359-37735381 ATGTATATGTCTAAGGGAGATGG - Intronic
1189070730 X:37861053-37861075 ATATATTTGTTTTAGGGTGAGGG - Intronic
1189653395 X:43214390-43214412 TTGTATTTCTGTAAGGTTGATGG - Intergenic
1190027853 X:46942383-46942405 TTGTATATGGTGAAAGGTAAGGG + Intronic
1192106543 X:68322614-68322636 TTTTATATGTTTAGTGGAGACGG - Intronic
1192736926 X:73858428-73858450 TTGTATATTTTTAATAGAGACGG + Intergenic
1192887672 X:75353211-75353233 TTTTGTATTTTTAGGGGTGACGG + Intergenic
1193181512 X:78463710-78463732 TTGTGTATGTTGTAAGGTGAGGG + Intergenic
1193633239 X:83916195-83916217 TTGTATATGCTATAAGGTGACGG + Intergenic
1193672438 X:84404516-84404538 TTCAATATGTTTAAAGGTAAAGG + Intronic
1193767338 X:85545989-85546011 TTATATATGTTTAAAGGCAAGGG + Intergenic
1193970741 X:88048731-88048753 TTGTATATGGCTAAAGGTAAGGG - Intergenic
1194019031 X:88664532-88664554 TTTTATATGTTATAGGGTAAAGG + Intergenic
1194497229 X:94631884-94631906 TTGTATATATATAAAGGTGTAGG + Intergenic
1194608784 X:96014719-96014741 CTGCATATGTTTAAGTGAGATGG + Intergenic
1195636802 X:107126661-107126683 TTGTATATAGTTAAAGGTGGGGG - Intronic
1195887918 X:109659837-109659859 TTGTATATGTTGTAAGGTGAAGG - Intronic
1196557243 X:117102199-117102221 TTGTATATGGTGAAAGATGAGGG + Intergenic
1196993313 X:121352121-121352143 TGGTATATCTTTCTGGGTGAAGG - Intergenic
1197257457 X:124278962-124278984 TTCTAAATGTTTGAGGTTGAGGG - Intronic
1197392731 X:125887576-125887598 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1198580057 X:138053626-138053648 TTGTATATGTTGAAAGGAAAGGG - Intergenic
1198642017 X:138766839-138766861 TTGTATATGGTGAAGGGTAGTGG + Intronic
1198716892 X:139567145-139567167 TTCTAAAGGTTTAAGAGTGATGG - Intergenic
1198758951 X:140011476-140011498 TTGTGTGTGTTTATGGGTGGCGG + Intergenic
1198779791 X:140222105-140222127 TTGTGTGTGTTTATGGGTGGCGG - Intergenic
1199015696 X:142812276-142812298 TTGTATATGGTGAATGGTAAGGG - Intergenic
1199043817 X:143145939-143145961 ATGTACATGTATAATGGTGAAGG - Intergenic
1199367483 X:147003936-147003958 TTGTATATGATGAAAGGTAAGGG + Intergenic
1200579333 Y:4929733-4929755 TTGTATATGTTGAAAGGTAGAGG - Intergenic
1201304677 Y:12540655-12540677 TTTTATATGTTTAATGGTGGGGG - Intergenic
1202588875 Y:26461151-26461173 TTGTATATGGTCAAAGGTGGGGG + Intergenic