ID: 1108234426

View in Genome Browser
Species Human (GRCh38)
Location 13:48388512-48388534
Sequence AATTTTCATCATAATCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108234425_1108234426 8 Left 1108234425 13:48388481-48388503 CCAGGCACTTTGGTGAGCACTTC 0: 1
1: 0
2: 7
3: 75
4: 625
Right 1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG 0: 1
1: 0
2: 3
3: 25
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108234426 Original CRISPR AATTTTCATCATAATCCATG AGG Intronic
901933204 1:12610041-12610063 AATTGTCATTATAAGCAATGAGG - Intronic
902471814 1:16652830-16652852 AATTTTTATCATACTGCATCGGG + Intergenic
902486992 1:16754615-16754637 AATTTTTATCATACTGCATCGGG - Intronic
905706511 1:40063848-40063870 AATTTTCCTCATGCTTCATGAGG - Intronic
907913555 1:58848347-58848369 AATTTTTGTCATAACCCTTGAGG + Intergenic
908411503 1:63870421-63870443 TATTTTCATCATAAATCTTGAGG + Intronic
910683947 1:89896939-89896961 AATTGTCATAATAATCCCTTTGG + Intronic
910850005 1:91640700-91640722 AATTTCCACAACAATCCATGAGG - Intergenic
911064731 1:93777940-93777962 AATTTCCAACAGAATTCATGTGG + Intronic
911296478 1:96123435-96123457 AATGTTGATTATAATCCATGTGG + Intergenic
911361497 1:96882724-96882746 ATTAATCTTCATAATCCATGAGG - Intergenic
911563440 1:99434219-99434241 GATTTTTAAAATAATCCATGTGG - Intergenic
911622455 1:100080566-100080588 CATTTTCTACATATTCCATGTGG + Exonic
912274872 1:108245678-108245700 TATTTTCATCATAATCCTTAAGG + Intergenic
912286393 1:108374114-108374136 TATTTTCATCATAATCCTTAAGG - Intergenic
912293347 1:108448679-108448701 TATTTTCATCATAATCCTTAAGG - Intronic
913640021 1:120803694-120803716 TATCTTCATCATAATCCTTAAGG - Intergenic
913991154 1:143613301-143613323 TATCTTCATCATAATCCTTAAGG + Intergenic
914212474 1:145592822-145592844 TATCTTCATCATAATCCTTAAGG + Intergenic
914251363 1:145924625-145924647 TATTTCTATCATAATCCCTGGGG + Intergenic
914278458 1:146146644-146146666 TATCTTCATCATAATCCTTAAGG + Intronic
914539505 1:148597592-148597614 TATCTTCATCATAATCCTTAAGG + Intronic
914627176 1:149474036-149474058 TATCTTCATCATAATCCTTAAGG - Intergenic
914940284 1:152016730-152016752 TATCTTCATCATAATCCTTAAGG - Intergenic
915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG + Intronic
917510139 1:175662877-175662899 AATCTTCATCATTATACTTGAGG - Intronic
917875071 1:179279091-179279113 ACTTCTCATCAGAATCAATGGGG - Intergenic
918735249 1:188053708-188053730 AAATTACATCATTATCCATTTGG + Intergenic
919198330 1:194317553-194317575 AATTTGGATAATAATCTATGTGG + Intergenic
919252775 1:195080479-195080501 AATTTTTATCATAATCTATGTGG - Intergenic
920192971 1:204206394-204206416 AACCTTCATCATGACCCATGGGG - Intronic
920661129 1:207915556-207915578 AATTTTGATCAAAATCCAAAAGG - Intergenic
920667720 1:207977023-207977045 AATTTTCCTCATCAAACATGAGG + Intergenic
921795516 1:219339270-219339292 AATTTTCACCATATTGCATAGGG - Intergenic
1063360405 10:5450641-5450663 AATTTTGATGAGAATCCAGGAGG - Intronic
1063854272 10:10230122-10230144 AATTTTAATAATAATCTAGGAGG + Intergenic
1066105528 10:32153506-32153528 ATTTCTCATCAGAAACCATGAGG - Intergenic
1068893104 10:62169014-62169036 AATTTACATCATACACTATGGGG + Intergenic
1070964449 10:80521037-80521059 AATTTTCATTGTTATTCATGGGG - Exonic
1071143211 10:82537107-82537129 AATTTTCACAAAAACCCATGAGG - Intronic
1071160201 10:82736598-82736620 AATTTTCCTGATACCCCATGAGG + Intronic
1072679533 10:97496983-97497005 AATTTTCATAATAAAATATGAGG + Intronic
1073144371 10:101270816-101270838 AATTTTCACCAAAAACCAAGTGG - Intergenic
1073961734 10:108938991-108939013 AATTTTCCTGATAATTCACGAGG - Intergenic
1074323776 10:112428398-112428420 GATTTTCATCATGGTCCATGAGG - Intergenic
1076015150 10:127021744-127021766 CATTATCATCATAATCCCAGTGG - Intronic
1078769664 11:14337021-14337043 ATTTCTCATCAGAAACCATGGGG + Intronic
1079781740 11:24615903-24615925 AATGTTCATCATTATCCATCAGG - Intronic
1080130023 11:28783002-28783024 GATTTTCATTAGAATGCATGTGG + Intergenic
1080662025 11:34304476-34304498 AATCTTCCTAATAACCCATGAGG + Intronic
1080942487 11:36935245-36935267 ACTTTTCTTCATAATTCATTTGG - Intergenic
1081158953 11:39729984-39730006 AATTTTTATATTAATCCATAGGG - Intergenic
1082170876 11:49003725-49003747 AATATTCATCATAATCTATTAGG + Intergenic
1082181920 11:49130329-49130351 AATTTTGAGCATAATCAAGGAGG - Intergenic
1083337868 11:61936719-61936741 ATTTCTCATCAGAAACCATGGGG + Intergenic
1083508379 11:63183066-63183088 CATTTACTTAATAATCCATGGGG + Intronic
1084754481 11:71226910-71226932 AAATTACAACATAATCTATGTGG + Intronic
1085967334 11:81543530-81543552 AATTGTCATCAAAATCCTTCAGG - Intergenic
1086683584 11:89704544-89704566 AATTTTGAGCATAATCAAGGAGG + Intergenic
1086694987 11:89832979-89833001 AATATTCATCATAATCTATTAGG - Intergenic
1086711161 11:90011515-90011537 AATATTCATCATAATCTATTAGG + Intergenic
1089024260 11:115252230-115252252 AATTCTCATAATAATCCTTTTGG - Intronic
1089957720 11:122587467-122587489 ATTTTTCATCAGAAACCATGGGG - Intergenic
1090541138 11:127707370-127707392 AATTTTCATGATATTTCATTTGG + Intergenic
1090610245 11:128464794-128464816 AATTGCCTTCATAATCCATAAGG + Intronic
1090914563 11:131151853-131151875 AATTTTAATCATGTACCATGGGG + Intergenic
1091487286 12:901802-901824 ATTTTTTATCATAATTAATGTGG - Intronic
1092667104 12:10814444-10814466 TATTTTCTTCAAAATTCATGTGG + Intergenic
1093553483 12:20443647-20443669 AATTTTCAACATAATTACTGTGG - Intronic
1095541756 12:43317624-43317646 ATTTTTCATAATTATGCATGCGG + Intergenic
1095973010 12:47917508-47917530 AATTTTCATAACAACCCTTGAGG + Intronic
1097677379 12:62617340-62617362 AATTTTCTGCCTATTCCATGGGG - Intergenic
1099594280 12:84638725-84638747 AATTTTGAACATAATCCACCTGG - Intergenic
1100622006 12:96285800-96285822 GAATTTCATCATAATCTCTGTGG + Intronic
1101850359 12:108397054-108397076 GATTCTCATTATAATCCATGGGG + Intergenic
1105698313 13:22912600-22912622 TATTTTCATCATTGTTCATGAGG - Intergenic
1106573919 13:30956834-30956856 AATTTTCAAGAAAATCCATATGG - Intronic
1108147002 13:47488408-47488430 AATTATCATTATAATCTATCTGG - Intergenic
1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG + Intronic
1108629702 13:52269416-52269438 ACTTTTCTTCATTCTCCATGGGG + Intergenic
1108656356 13:52537072-52537094 ACTTTTCTTCATTCTCCATGGGG - Intergenic
1109304401 13:60622653-60622675 AATTTCAATCATCATCCAAGAGG + Intergenic
1109367591 13:61376700-61376722 AATTTTCATTAAAATGAATGTGG + Intergenic
1110231110 13:73168512-73168534 AATTCTCATAACAATCCAGGTGG + Intergenic
1110481185 13:75978716-75978738 CCTTTTCATCTTAATCCATGGGG - Intergenic
1110851685 13:80253208-80253230 AATTTTCACAATAATCTATGAGG + Intergenic
1110905999 13:80889977-80889999 AAGTTTCCTCATAACCCATTTGG + Intergenic
1110954996 13:81543209-81543231 AATTTTTATCATACCCCAAGGGG + Intergenic
1111298906 13:86320470-86320492 AATTCTCATCACAGACCATGGGG + Intergenic
1111423355 13:88047119-88047141 CATTTTCTTCATAATTGATGGGG - Intergenic
1111461750 13:88553345-88553367 ATTTTTCATCAGAAACCATAGGG - Intergenic
1111577693 13:90179391-90179413 AAGTTTCATGATAATGCATCTGG - Intergenic
1112590106 13:100755408-100755430 CATTTTCTTCATAACCCATTTGG - Intergenic
1113332954 13:109348661-109348683 AATGGTCATCAAAATGCATGAGG + Intergenic
1115417344 14:33151542-33151564 AATTTTCAAAATAAATCATGAGG - Intronic
1115701298 14:35955503-35955525 AATAATAATAATAATCCATGTGG + Intergenic
1116131965 14:40866003-40866025 AATTTACATCATAAGGTATGGGG - Intergenic
1116453911 14:45095635-45095657 AATTTTAATCATAAACAATAAGG - Intronic
1116737078 14:48705287-48705309 AATTTACATCAGGATCCATAGGG - Intergenic
1116979248 14:51150400-51150422 AATCTTCATCCTCATCTATGAGG - Intergenic
1117198689 14:53365673-53365695 AATCATCATCATAATCCACTTGG + Intergenic
1117452773 14:55866746-55866768 AATTTTTATCATAATGAATTTGG + Intergenic
1117889198 14:60399517-60399539 TATTTCTATCATAATCCCTGGGG - Intronic
1118912130 14:70070343-70070365 AATATTCATAATAACCTATGAGG + Intronic
1119959707 14:78841274-78841296 AATCATCATCATCATCCATCTGG - Intronic
1120054573 14:79908324-79908346 GATGATCATCATAATCCAGGGGG + Intergenic
1120988912 14:90357779-90357801 AATTTTCCTAACAATACATGAGG - Intergenic
1122839922 14:104452819-104452841 TATTTTCATCATTGTTCATGAGG - Intergenic
1126926428 15:53592638-53592660 AAATTTCATGCTAAACCATGTGG - Intronic
1128033795 15:64505273-64505295 AATTTTCATTATAATAATTGAGG + Intronic
1128690923 15:69724316-69724338 AATTTTCATAATAATCATGGGGG - Intergenic
1131935216 15:97496717-97496739 ACTTTTCATCATAATTCAAATGG + Intergenic
1135570378 16:23544794-23544816 AATCCTCATAACAATCCATGAGG + Intronic
1135786478 16:25353815-25353837 AAGTTAAATCAGAATCCATGAGG - Intergenic
1139762233 16:69194536-69194558 AATTTTAATCAAAATCCCAGAGG - Intronic
1140770268 16:78197333-78197355 AATTTACAGCATCATCCAGGAGG - Intronic
1141319617 16:82995117-82995139 AATTATCATCACAACCCAAGTGG + Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144248322 17:13390458-13390480 AATTTTCAAAATCATCCCTGGGG + Intergenic
1146771868 17:35576268-35576290 ATTTTTCATCAGAATCACTGGGG + Intronic
1147714959 17:42499884-42499906 AATTTTCATCAAAATAAGTGAGG + Intronic
1149350004 17:55776790-55776812 ATTTTTCCTCATCATCCATGAGG + Exonic
1149679412 17:58494934-58494956 AATCATCCTCATAGTCCATGGGG + Exonic
1150147440 17:62780867-62780889 CATTTTCATCATCTTCTATGGGG + Intronic
1153862351 18:9225794-9225816 TATTTTCATAATAATGTATGGGG - Intronic
1155102692 18:22628505-22628527 AAGATTCATCATATTCCAGGGGG + Intergenic
1155231514 18:23779321-23779343 AAGTTTTTCCATAATCCATGAGG + Intronic
1155328636 18:24691859-24691881 AATTTTCATCTTTATTAATGTGG - Intergenic
1156034298 18:32749620-32749642 TACTTTCAACATAATCCAGGAGG + Intronic
1156288831 18:35726693-35726715 AATGTTCATAATAATCTCTGAGG - Intergenic
1156845126 18:41657057-41657079 AATTTTGCTCAAAATCCATGAGG - Intergenic
1157759888 18:50253603-50253625 AATCTTCATAATAATCAATATGG + Intronic
1157791324 18:50533828-50533850 ATTTCTCATCAGAATCCATATGG - Intergenic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1164560088 19:29285511-29285533 AAATTGCATCATAAACTATGTGG - Intergenic
1164795246 19:31021485-31021507 TATATTCAACATTATCCATGTGG - Intergenic
1167580381 19:50337744-50337766 ATTTGTCATCATATTCCATTTGG - Intronic
1168361385 19:55743672-55743694 AATTTTCATCATAATATATGGGG + Intergenic
1202704214 1_KI270713v1_random:9623-9645 AATTTTTATCATACTGCATCGGG + Intergenic
926563336 2:14441788-14441810 AAATTTAAACATAATCCTTGAGG + Intergenic
929354424 2:41002438-41002460 TATTTTTGTCATAATCCATCCGG + Intergenic
929747716 2:44676257-44676279 AATTTTAATCTCCATCCATGTGG + Intronic
930258634 2:49119718-49119740 AATTTTCAACATAAAACAAGTGG + Intronic
930436179 2:51345992-51346014 AATTTTCATAATAATTCTTCAGG - Intergenic
933275357 2:80278143-80278165 AATTTTTACCATACTCTATGAGG - Intronic
934474191 2:94581997-94582019 ATTTTTTATAATAAACCATGTGG - Intergenic
935267867 2:101409904-101409926 GATTTTCATCATCCTCCATGGGG - Intronic
938050077 2:128161589-128161611 ACTTTTCATCATTATCTATTTGG + Intronic
939530846 2:143359693-143359715 AATGTTTATCATAATACATTTGG + Intronic
939655789 2:144822774-144822796 AATTTTCAGCTCATTCCATGAGG + Intergenic
941135270 2:161708836-161708858 TATTATCATCATAATTCATGAGG - Intronic
941467769 2:165850348-165850370 AATTAACATCATAATAAATGGGG - Intergenic
941543777 2:166819475-166819497 AGTTTTCCTCATAATGCCTGAGG + Intergenic
942448681 2:176095123-176095145 GATTATCTTCATAATCCATTAGG + Exonic
942637423 2:178022709-178022731 ATATTTCATTATAATCCTTGAGG - Intronic
944042572 2:195372980-195373002 AACTTTCCACCTAATCCATGAGG - Intergenic
945321508 2:208429134-208429156 AATTTTGATAATTTTCCATGTGG + Intronic
946379569 2:219336530-219336552 ATTTTTCATTATAAACCATGTGG + Intergenic
947011143 2:225568338-225568360 AATACTCAACATTATCCATGTGG - Intronic
947099368 2:226603317-226603339 AATTTTAATGCTAATCCATAAGG + Intergenic
947273037 2:228360215-228360237 AATATTCATCATATTCTTTGAGG - Intergenic
1170161862 20:13321342-13321364 AATTGTCATCAGTATTCATGTGG - Intergenic
1170861026 20:20103815-20103837 AATTTTCTTGATAATGCATAAGG + Intronic
1172266158 20:33616323-33616345 AATTTTTATTATAAACCAGGAGG + Intronic
1175020833 20:55847206-55847228 AATTTTAATCAAAATCCCAGAGG - Intergenic
1175568566 20:60000613-60000635 AATTTTCACCAGAACCCATAGGG + Intronic
1177875081 21:26622741-26622763 AATTTACATCTTAACCCATCTGG + Intergenic
1177888955 21:26781686-26781708 AGTATTCAGCATAAACCATGCGG + Intergenic
1182194474 22:28501754-28501776 CATTTTCATGATAATGCAAGTGG + Intronic
1182899051 22:33882974-33882996 CATTTTCAACATAATTCATCTGG - Intronic
1183110835 22:35647239-35647261 AATTGTGATCAGAAGCCATGTGG - Intergenic
1184435909 22:44475954-44475976 ATTTCTCATCAGAAACCATGCGG - Intergenic
1184795002 22:46727130-46727152 GATTTTCTTCATCATCCGTGCGG - Intronic
950448591 3:13053030-13053052 AGTTTTCATCCGAATCCACGGGG + Intronic
950697304 3:14712990-14713012 ATTTCTCATCAGAAACCATGGGG - Intronic
950926081 3:16743953-16743975 ATTTTTCATTATTATACATGAGG + Intergenic
951106366 3:18747976-18747998 AACCTTCATAATAATCCCTGAGG + Intergenic
951119526 3:18908891-18908913 AATTTTTATCATACTGCATTGGG - Intergenic
953231812 3:41072020-41072042 AATATTCATCCCACTCCATGTGG - Intergenic
953354889 3:42247584-42247606 TATTTTCACCCTTATCCATGGGG - Intergenic
954503987 3:51050910-51050932 AATTTTCATTAAAATATATGTGG - Intronic
955278535 3:57571395-57571417 CATTTTCTTCATAACCCATTTGG - Exonic
955649973 3:61183618-61183640 AATCTTTATCACAATTCATGGGG - Intronic
955944999 3:64185131-64185153 AATTTTGATCATCAACCCTGAGG + Intronic
956156598 3:66304808-66304830 AATTTTTATCACAATTCATTTGG - Intronic
956688571 3:71855265-71855287 TATTTTAATCTTTATCCATGAGG - Intergenic
956913917 3:73850869-73850891 AATTTTCTGCATAATCAAAGTGG + Intergenic
957573703 3:81982438-81982460 AATTTTTATTATAATAAATGAGG - Intergenic
957597375 3:82284894-82284916 AATATTCATCATAATTTATCTGG - Intergenic
959211160 3:103383026-103383048 AATTTTCATTAAAATACATCAGG + Intergenic
960246055 3:115401586-115401608 AAGGATAATCATAATCCATGTGG + Intergenic
963398409 3:144763803-144763825 AAGTTTCACCATATTCCATCTGG + Intergenic
963655805 3:148048820-148048842 ATTTTTCATTAGAAACCATGGGG - Intergenic
964807432 3:160626683-160626705 AATTTTCATATAGATCCATGAGG - Intergenic
965460822 3:168960639-168960661 AATTTACATCAAAATCCCAGGGG - Intergenic
966046045 3:175551022-175551044 ATTTTTTATCAAAATCCATTTGG + Intronic
966384850 3:179385346-179385368 AATTTTCATAATATACAATGGGG - Intronic
966658523 3:182387354-182387376 AATCTTCATGATAACCTATGAGG - Intergenic
969027805 4:4188608-4188630 AAGTTAGATCAAAATCCATGAGG - Intergenic
972698534 4:41471546-41471568 AATTTTCATCAAATGCCAGGTGG - Intronic
973028563 4:45305564-45305586 AATTTTCATTTTTTTCCATGTGG - Intergenic
974679621 4:65144602-65144624 AAATTTTAGCAGAATCCATGTGG + Intergenic
976096370 4:81512619-81512641 AATGTTTATCATTCTCCATGGGG - Intronic
977147198 4:93458616-93458638 AATTCTCATAAAAACCCATGAGG - Intronic
978107834 4:104926066-104926088 TATTTTCATCATCATTTATGTGG - Intergenic
978113436 4:104990719-104990741 AATGTTCATTAAAATCTATGTGG + Intergenic
979199220 4:117956981-117957003 AATTTTCACAAGAATCCTTGTGG - Intergenic
980119503 4:128713248-128713270 ACTTTCCATCATAATCAGTGTGG + Intergenic
980147482 4:129006586-129006608 AATTATCTTAATAATCAATGGGG - Intronic
980638960 4:135547756-135547778 AATTTTCTTAAAACTCCATGTGG - Intergenic
980765054 4:137291296-137291318 AAGTTTCATCAAAATTCAGGAGG + Intergenic
982776138 4:159443430-159443452 AATTTTTATAAAACTCCATGGGG + Intergenic
984116541 4:175688395-175688417 CAATTTCATCATATTGCATGTGG + Intronic
984202996 4:176750087-176750109 AATTTTCAGCAAAATCCAAAAGG + Intronic
984579125 4:181489443-181489465 AATTTAAATTATAATCAATGCGG + Intergenic
984715274 4:182918735-182918757 AATCATCATCTTAATCTATGTGG - Intergenic
987580104 5:19779088-19779110 AATTTTTATATTAATACATGAGG + Intronic
987952926 5:24699483-24699505 GTTTTTCCTCATAATACATGTGG + Intergenic
988016678 5:25568415-25568437 AATTTACATCATAAGGTATGGGG - Intergenic
988171630 5:27664551-27664573 ATTTTTCATCATACACCAAGAGG - Intergenic
988223026 5:28374388-28374410 AAATTTCATCACAATCTATAGGG - Intergenic
988431008 5:31118564-31118586 AAATTTAATCATAATACAAGTGG + Intergenic
988982834 5:36588576-36588598 AATTTTCATCCGAATCCACTGGG - Intergenic
989715721 5:44459914-44459936 CATTCACAACATAATCCATGAGG + Intergenic
990446686 5:55899692-55899714 AAATTTCATCTAATTCCATGAGG - Intronic
990929020 5:61065728-61065750 AGTTAACATTATAATCCATGGGG + Intronic
992302263 5:75395115-75395137 AATTTGCAGCTTAATCTATGGGG - Intronic
992843969 5:80726268-80726290 AATCTTCATCCTACTCCATATGG + Intronic
993306441 5:86280871-86280893 TATTTTCATCATAATCCTTAAGG - Intergenic
993963839 5:94335729-94335751 CATTTTCATCATAATCAATATGG - Intronic
993988327 5:94624431-94624453 AGTTTTCATCTTAAACCATATGG - Intronic
994072494 5:95618883-95618905 TATTTTCATCATCATCTCTGTGG - Intergenic
994465211 5:100118769-100118791 AATATTCATCATAATTTATCAGG + Intergenic
994567085 5:101463279-101463301 AATTTAGATCATAATCCAATTGG - Intergenic
994752396 5:103754355-103754377 AATTTTCTTGAGAATCTATGTGG - Intergenic
995992440 5:118257969-118257991 TATTTTCATTATAATCCTTGTGG + Intergenic
996125631 5:119722578-119722600 AATATTCATCCTTCTCCATGTGG - Intergenic
996656562 5:125944387-125944409 TATTTTCATTATAATGCATGAGG - Intergenic
997706523 5:135959011-135959033 AATTTTAAGCATAATACATTAGG + Intergenic
998361162 5:141588940-141588962 AATTTTCATAAAAATCCTTATGG + Intronic
999062013 5:148646144-148646166 CATTTTCATCAGAATCACTGGGG - Intronic
1000307948 5:160013437-160013459 ACTTTTCATCATTATTAATGAGG - Intronic
1000522366 5:162311785-162311807 CTTTCTCATCATAAACCATGAGG + Intergenic
1000874671 5:166621066-166621088 ATTCCTCATCACAATCCATGAGG - Intergenic
1001022392 5:168194646-168194668 AAAATTTCTCATAATCCATGAGG - Intronic
1004046773 6:12032635-12032657 AATTTTCAAAATAACCCATAAGG - Intronic
1004598492 6:17124599-17124621 AATTTTCATCATAATCTTGCTGG + Intronic
1004922012 6:20384590-20384612 AATTTTCAAAATAAGCAATGAGG - Intergenic
1005853573 6:29842190-29842212 AATTTTCATCAGAAACCATGGGG - Intergenic
1005887784 6:30110283-30110305 CATTTTCATTCTAATACATGCGG + Intronic
1007030883 6:38624783-38624805 AATTTTCATCATGTCCTATGAGG + Intronic
1007054160 6:38865207-38865229 ATTTATCATCTTTATCCATGGGG - Intronic
1008234826 6:49031917-49031939 TATATTCATCATAATCTCTGTGG - Intergenic
1008323252 6:50144292-50144314 ATATTTCATCATAAAACATGAGG - Intergenic
1008606793 6:53148076-53148098 AATTTTACTTAAAATCCATGAGG - Intronic
1010132864 6:72515743-72515765 AATTCTCATCAGAAACCACGAGG - Intergenic
1010573498 6:77506213-77506235 TATTTACATCATAATCAAGGTGG + Intergenic
1011512943 6:88121384-88121406 AATTCTGATTATAATCCATTTGG - Intergenic
1012741710 6:103024299-103024321 AATTTTGATCAAAATCTCTGAGG + Intergenic
1013968175 6:115981902-115981924 AAATTTCATCATATTTAATGAGG + Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014466198 6:121760032-121760054 AATGATCATCCTAATCCATCAGG - Intergenic
1014799055 6:125757321-125757343 GCTTTTCATCCTAATCCAAGAGG + Intronic
1014803074 6:125798776-125798798 AATTATCATTATAATACATATGG - Intronic
1014886339 6:126786021-126786043 AAGTTTCATCTTAATCTTTGTGG - Intergenic
1014925457 6:127265584-127265606 AATTCTCATAATAAACTATGAGG - Intergenic
1015584667 6:134763334-134763356 AATGTTCATGATAATCCAATGGG + Intergenic
1016021477 6:139240565-139240587 AATATTCACCATAATCCAGGAGG - Exonic
1016174515 6:141063399-141063421 CAATTTCTTCATAATCCAAGAGG - Intergenic
1016477027 6:144438844-144438866 ATTTTACATCATCATCCAGGGGG - Exonic
1016617843 6:146073614-146073636 AAGTGTCATCAAAATCCAAGTGG + Intronic
1017275468 6:152562353-152562375 AATATACATCCTAATGCATGAGG - Intronic
1017413395 6:154193985-154194007 AGTTTACATCATAATAAATGTGG + Intronic
1020534277 7:9374814-9374836 AATTTCCATGATATTCTATGTGG + Intergenic
1020925752 7:14321966-14321988 AATTTTATTCAAAATCCCTGTGG + Intronic
1021235913 7:18142389-18142411 AATTTTCATTCTTATCCCTGAGG + Intronic
1023419916 7:39968366-39968388 TATTTTCATTATTCTCCATGTGG + Intronic
1023656753 7:42430631-42430653 CATTTTCTCCATAACCCATGTGG + Intergenic
1024519466 7:50292077-50292099 AATTTCCATCATATTACAGGTGG - Intergenic
1024586127 7:50843640-50843662 AGTTTTCATCTGAATCCATTGGG + Intergenic
1024679921 7:51675039-51675061 CAGTAACATCATAATCCATGGGG + Intergenic
1028024141 7:85815751-85815773 AATTTAGATCATATTCCAAGAGG - Intergenic
1028350909 7:89846736-89846758 AATTTTAATTATAATGCATATGG - Intergenic
1029971467 7:104793730-104793752 GATTTTCATCATAATCAAGTTGG - Intronic
1033090861 7:138384860-138384882 AATTTTCACCAGCATGCATGAGG - Intergenic
1037052705 8:14396417-14396439 AATTCTCACCATTTTCCATGAGG - Intronic
1037988386 8:23303641-23303663 AATGATCATCGTAATGCATGGGG + Intronic
1038560954 8:28579515-28579537 AAGTGACACCATAATCCATGAGG - Intergenic
1038781471 8:30571885-30571907 AATTTTCAACATAAGCCGAGCGG - Intronic
1039459291 8:37729866-37729888 AATGCTCATAATAGTCCATGAGG - Intergenic
1039643841 8:39257031-39257053 AATTGTAATCATAATCCTTGGGG - Intronic
1040687350 8:49890832-49890854 AATTATCAAATTAATCCATGGGG - Intergenic
1041190567 8:55349750-55349772 AATTTTAATGATAATACATAAGG + Intronic
1041503244 8:58562625-58562647 CATATTCATTATTATCCATGTGG - Intronic
1043065479 8:75565397-75565419 CGTTTTCATCAGAATCCATCCGG - Exonic
1043695837 8:83216180-83216202 CATTTTCTTCATAACCCATTTGG + Intergenic
1043999184 8:86857491-86857513 AATTTTCATGAAAGTCTATGAGG - Intergenic
1045559486 8:103247152-103247174 AATTTTTATCATAAACAATTGGG + Intergenic
1046183788 8:110687078-110687100 AATATTCATTTTAATCCATCTGG - Intergenic
1046676391 8:117113415-117113437 CATCTTCATAATAATACATGAGG - Intronic
1047833973 8:128667768-128667790 ATTTTACACCATACTCCATGTGG + Intergenic
1048984012 8:139721277-139721299 ACTTATCTTCAGAATCCATGGGG - Intergenic
1052297141 9:26909478-26909500 AATTCTCATCATAATCTTTGTGG + Intronic
1052419726 9:28227035-28227057 AATCTTCATAATAATCCAATGGG - Intronic
1052659830 9:31414409-31414431 AATGTGCTTCATTATCCATGAGG + Intergenic
1052765381 9:32635156-32635178 CATCTTCATCATAATCCGAGTGG + Exonic
1052767785 9:32659476-32659498 CATTTGCATAACAATCCATGAGG + Intergenic
1052791653 9:32880429-32880451 AATTTTCATCAGCCTCCAAGGGG + Intergenic
1053683887 9:40504134-40504156 ATTTTTTATAATAAACCATGTGG + Intergenic
1053933861 9:43132420-43132442 ATTTTTTATAATAAACCATGTGG + Intergenic
1054279834 9:63120818-63120840 ATTTTTTATAATAAACCATGTGG - Intergenic
1054296983 9:63339600-63339622 ATTTTTTATAATAAACCATGTGG + Intergenic
1054395001 9:64644106-64644128 ATTTTTTATAATAAACCATGTGG + Intergenic
1054429648 9:65149306-65149328 ATTTTTTATAATAAACCATGTGG + Intergenic
1054500734 9:65872225-65872247 ATTTTTTATAATAAACCATGTGG - Intergenic
1055432340 9:76256942-76256964 AGTTTTCATCATAATCTCTAGGG - Intronic
1056065663 9:82931737-82931759 AATTTTCAGCATGATAAATGTGG - Intergenic
1056113516 9:83420207-83420229 ACTTTCTATCATCATCCATGAGG - Intronic
1059623129 9:116030996-116031018 AAGTTTCCTCATATCCCATGTGG + Intergenic
1060097411 9:120804265-120804287 ATTATTCATCATAATCCAGTGGG - Intergenic
1060380013 9:123159979-123160001 AATTTTCATGGTAATGCAAGGGG + Intronic
1061563162 9:131419704-131419726 TATGTTCATCTTAATCCACGAGG + Intronic
1186386392 X:9114403-9114425 AATTTGCAACAGAGTCCATGTGG - Intronic
1187170417 X:16846290-16846312 AATGTTCATCATAATCAGTATGG - Intronic
1187787029 X:22903252-22903274 AGCTAACATCATAATCCATGAGG - Intergenic
1188363674 X:29287654-29287676 AATTTTAATCATTAGCCATTAGG - Intronic
1188900320 X:35724287-35724309 AATTTTCAAAATAAATCATGAGG - Intergenic
1188934714 X:36160077-36160099 AAATTTCTTTATAATCCATTTGG - Intergenic
1190583730 X:51915942-51915964 AATTAATATCATAATCAATGGGG + Intergenic
1192078245 X:68022147-68022169 AATTTTCATCAATATCCCTTAGG - Intergenic
1193538917 X:82746878-82746900 AATTTACATCATAAGGTATGGGG + Intergenic
1193589611 X:83372310-83372332 AGTTAACATCATAATCAATGGGG - Intergenic
1194133904 X:90114905-90114927 AATGTTCATCATAACCCTAGCGG + Intergenic
1194731416 X:97459941-97459963 AATCCTCATAATAACCCATGAGG - Intronic
1195539626 X:106047832-106047854 AATTTCCATCTTCATTCATGAGG - Intergenic
1196159983 X:112472667-112472689 ATTTTTCATCAGAAATCATGGGG - Intergenic
1196176613 X:112645521-112645543 AATTCTCACAACAATCCATGAGG + Intronic
1197100127 X:122643261-122643283 AATCTTCATCATAGTGCATCAGG - Intergenic
1197133339 X:123031558-123031580 AAGTTTCTATATAATCCATGTGG - Intergenic
1198881990 X:141291799-141291821 AAATGTCATCAGAATCCATCAGG - Intergenic
1200891842 Y:8332318-8332340 TTATTTCATAATAATCCATGTGG - Intergenic
1201380522 Y:13372395-13372417 AATTTTCATTATTTTCAATGTGG - Intronic