ID: 1108236809

View in Genome Browser
Species Human (GRCh38)
Location 13:48416587-48416609
Sequence CTGTTAACTCCCCTGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 14, 3: 187, 4: 532}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108236804_1108236809 9 Left 1108236804 13:48416555-48416577 CCAGTGGCACCTGAAACACCAGT 0: 4
1: 43
2: 140
3: 305
4: 632
Right 1108236809 13:48416587-48416609 CTGTTAACTCCCCTGGAACAGGG 0: 1
1: 0
2: 14
3: 187
4: 532
1108236806_1108236809 -9 Left 1108236806 13:48416573-48416595 CCAGTGAGACAGAACTGTTAACT 0: 2
1: 82
2: 220
3: 435
4: 616
Right 1108236809 13:48416587-48416609 CTGTTAACTCCCCTGGAACAGGG 0: 1
1: 0
2: 14
3: 187
4: 532
1108236805_1108236809 0 Left 1108236805 13:48416564-48416586 CCTGAAACACCAGTGAGACAGAA 0: 3
1: 97
2: 241
3: 473
4: 700
Right 1108236809 13:48416587-48416609 CTGTTAACTCCCCTGGAACAGGG 0: 1
1: 0
2: 14
3: 187
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108236809 Original CRISPR CTGTTAACTCCCCTGGAACA GGG Intronic
902141609 1:14361438-14361460 CTGTTCACTCCTCTGGAAGAGGG - Intergenic
902702930 1:18184932-18184954 CTGTTTTCTCACCTGGAAAATGG + Intronic
903345476 1:22681567-22681589 CTGTTTCCTCCCCTGGAAAATGG - Intergenic
904131556 1:28279411-28279433 CTGTTTACTCACCTGTAAAATGG + Intronic
904624091 1:31792507-31792529 CTGTTTCCTCCTCTGGAAGATGG - Intronic
905316300 1:37083592-37083614 CAGATAACTCCCCAGTAACAGGG + Intergenic
905735119 1:40319650-40319672 CTGTTCCCTCCCCTTGATCATGG - Intergenic
906586729 1:46984859-46984881 TTGTTCACTCCCCTGGAAAGGGG + Intergenic
906604144 1:47153487-47153509 TTGTTCACTCCCCTGGAAAGGGG + Intergenic
906843122 1:49161039-49161061 CTGTTCACTCCCCTGGAAAGGGG - Intronic
908095560 1:60733490-60733512 CTGCTCAGTCCCCAGGAACAAGG + Intergenic
908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG + Intergenic
908598607 1:65714630-65714652 ATGTAAAATCCCCAGGAACAGGG - Intergenic
909403274 1:75258192-75258214 CTGTTCACTCCCCTAGAAAGGGG + Intronic
911530680 1:99039692-99039714 CTGTTCACTCACCTGGAAAGCGG + Intergenic
911692071 1:100845629-100845651 CTGTTCACTCCCCTGGAAAGAGG - Intergenic
912675777 1:111679563-111679585 CTGTTCACTCCCCTGGAAAGGGG + Intronic
913021473 1:114792325-114792347 CTGTTCACTCACCTGGAAAGAGG - Intergenic
913036320 1:114969633-114969655 CTGTTCGCTCCCCTGGAAAAGGG - Intronic
913108682 1:115639461-115639483 CTGCTCACTCCCCTGGAATGGGG - Intergenic
913962318 1:143349866-143349888 CTGTCAACTTCACTGGAAGAAGG + Intergenic
914056674 1:144175442-144175464 CTGTCAACTTCACTGGAAGAAGG + Intergenic
914122472 1:144790920-144790942 CTGTCAACTTCACTGGAAGAAGG - Intergenic
914458029 1:147855010-147855032 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
914967148 1:152270138-152270160 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
914969219 1:152291979-152292001 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
915663598 1:157424414-157424436 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
916406252 1:164500630-164500652 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
916625619 1:166552408-166552430 CTCTTCACTCCCCTGGAAAAAGG - Intergenic
916731620 1:167571901-167571923 CCATTCACTCCCCTGGAAAAGGG - Intergenic
916938522 1:169656416-169656438 GTGTTCACTCCCCTGGAAAGGGG + Intergenic
916973426 1:170048977-170048999 CTGTTCACTGCCCTGGAAAGGGG + Intronic
917009792 1:170458050-170458072 CTGTTCACTCTCCTGGAAAGGGG - Intergenic
917023395 1:170614518-170614540 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
917163168 1:172080613-172080635 CCGTTCACTCCCCTGGAAAGGGG - Intronic
917357740 1:174144022-174144044 CTGTTCACTCTCCTGGAAAGGGG + Intergenic
917405951 1:174708824-174708846 CTGTTCACTCCCCTGGAAAGGGG + Intronic
918163338 1:181920886-181920908 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
918195636 1:182218929-182218951 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
918353698 1:183684577-183684599 CGGTTCACTCCCCTGGAAAGGGG - Intronic
918632111 1:186730589-186730611 CTGTTCACTCCCCTGGAAACGGG - Intergenic
918684379 1:187396966-187396988 CTGTTCACTCTCCTGGAAAGGGG + Intergenic
919146800 1:193645387-193645409 CTGTTCACTCCCCTGGAAAAGGG - Intergenic
919601872 1:199632997-199633019 CGGTTCACTCCCCTGGAAAGGGG + Intergenic
920254020 1:204642154-204642176 CTGTTAATTCCCTGGGAAAATGG - Intronic
921296877 1:213712503-213712525 CCGTTGACTCCCCTGGAAAGGGG - Intergenic
922666513 1:227474043-227474065 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
924829035 1:247573159-247573181 CTGTTTACTCCCCTGGAAAAGGG - Intronic
924878196 1:248128742-248128764 CTGTCCACTCCCCTGGAAAGGGG + Intergenic
924894075 1:248316969-248316991 CTGTCCACTCCCCTGGAAAGGGG - Intergenic
1063039230 10:2319845-2319867 GTGTCAACTCCCCTGGGAGATGG - Intergenic
1063337973 10:5234945-5234967 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1064247617 10:13681788-13681810 CTGTTTCCTCCCCTGTAAAATGG + Intronic
1064757831 10:18587927-18587949 CCGTTTACTCCCCTGGAAAGGGG + Intronic
1065076025 10:22080277-22080299 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1065621585 10:27587471-27587493 CTGTTCACTCCCCTGGAAAGAGG + Intergenic
1066054572 10:31668493-31668515 CTGTTACCTCACATGGAAGAAGG + Intergenic
1066257663 10:33696273-33696295 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1067158708 10:43804141-43804163 CTGGAAACTCACCTGGAAAACGG + Intergenic
1067162188 10:43836545-43836567 CTGTTCACTACCCTGGAAAGAGG - Intergenic
1067236400 10:44454179-44454201 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1068469979 10:57448467-57448489 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1068575139 10:58676276-58676298 CTGTTCACTACCCTGGAAGGGGG + Intronic
1068933462 10:62614329-62614351 CTGTTTACTCCCCTAGGCCATGG - Intronic
1069139941 10:64810423-64810445 CTGTTCACTGCCCTGGAAAGGGG - Intergenic
1069349001 10:67502956-67502978 CTGTTTGCTCCCCTGGAAAGGGG - Intronic
1070213146 10:74347570-74347592 CTGTTAACTCCCCTGGAAAGGGG + Intronic
1070234487 10:74609226-74609248 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1071272395 10:84020067-84020089 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1071521587 10:86334732-86334754 CGGTTTCCTCCTCTGGAACATGG - Intronic
1071975877 10:90955289-90955311 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1072358985 10:94640334-94640356 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1072872275 10:99132890-99132912 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1073368494 10:102965455-102965477 CTGATTACTCCCCTGGAAGGAGG - Intronic
1073424077 10:103445831-103445853 CAGGGAACTCCCCTGGAAGAGGG - Exonic
1073448114 10:103592979-103593001 CTCTGAGCTCCCCAGGAACAAGG + Intergenic
1074798988 10:116979672-116979694 CTGTCACCTCTCCTGGATCATGG - Intronic
1077696414 11:4397022-4397044 CTGTTCACTCCCTTGGAAAGGGG + Intergenic
1079264845 11:18921233-18921255 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1079267020 11:18943380-18943402 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1080424034 11:32139813-32139835 CTGTTATCTCCCTTGACACATGG + Intergenic
1081118260 11:39232231-39232253 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1081221567 11:40469533-40469555 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1082120807 11:48378129-48378151 CTGCTACCTCCACTGGAGCAAGG - Intergenic
1082253023 11:50002513-50002535 CTGCTACCTCCACTGGAGCAAGG + Intergenic
1082872164 11:57953522-57953544 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1082876349 11:57992682-57992704 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1082924357 11:58530200-58530222 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1084090524 11:66876651-66876673 CCGATAACTCGCCTGGAGCAGGG - Intronic
1085321075 11:75574451-75574473 CTGTTATCTCACCTGTAAGATGG - Intergenic
1086129177 11:83383145-83383167 CTGATTACTCCCCTGGAAAGGGG + Intergenic
1086421888 11:86645214-86645236 CTATTCACTCCCCTGGAAAGGGG + Intronic
1086505270 11:87497832-87497854 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1086732849 11:90271051-90271073 CTGTTCACTCCCCTGGAAGGGGG - Intergenic
1086735683 11:90302627-90302649 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1086767719 11:90718847-90718869 ATGCTTACTCCCCTCGAACATGG + Intergenic
1087305736 11:96487291-96487313 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1088034637 11:105296643-105296665 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1089293861 11:117456503-117456525 CAGTTTTCTCCCCTGTAACATGG + Intronic
1090725123 11:129518090-129518112 CCATTCACTCCCCTGGAAAAGGG - Intergenic
1090986611 11:131772439-131772461 CTGATACCTCCCCTTTAACAGGG - Intronic
1091090055 11:132762802-132762824 CCATTAACTCCCCTGGAAAGGGG - Intronic
1092258971 12:6942304-6942326 CTCACAACTCCCCAGGAACATGG + Exonic
1092440378 12:8496061-8496083 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
1092581708 12:9849579-9849601 CTATTCACTCCCCTGGAAAGGGG - Intergenic
1092637430 12:10466890-10466912 CTGTTCACTTCCCTGGAAAGGGG - Intergenic
1093545073 12:20336599-20336621 ATGTTCACTCCCCTGGAAAGGGG - Intergenic
1093610502 12:21149853-21149875 CCCTTCACTCCCCTGGAAAAGGG + Intronic
1093664490 12:21795538-21795560 CTGTTCACTTCCCTGGAAAGGGG - Intergenic
1093694731 12:22146634-22146656 CTGTTCATTCCCCTGGAAAGGGG + Intronic
1094733135 12:33200856-33200878 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
1094782085 12:33802820-33802842 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1095119957 12:38405350-38405372 CTGTTAACATCCCTGGAAAGGGG - Intergenic
1095230519 12:39733891-39733913 CTGTTCATTCCCCTGGAAAGGGG - Intronic
1095510852 12:42950144-42950166 CTGTGAACTCCATAGGAACAAGG + Intergenic
1095646975 12:44558826-44558848 CCGTTCACTACCCTGGAAAAGGG + Intronic
1097412105 12:59268058-59268080 CTGTTCACTTCCCTGGAAAGGGG + Intergenic
1097737361 12:63196673-63196695 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1097898822 12:64853478-64853500 CTGTTCACTCCTCTGGAAAGGGG - Intronic
1098438810 12:70497192-70497214 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1098697041 12:73572547-73572569 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1098780144 12:74676537-74676559 CGGTTCACTCCCCTGGAAAGGGG + Intergenic
1099030808 12:77523936-77523958 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1099236129 12:80084263-80084285 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1099554751 12:84097577-84097599 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1100870597 12:98906424-98906446 CTGTTCCCTCCCCAGGAACATGG - Intronic
1100896246 12:99185893-99185915 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1101069888 12:101062873-101062895 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1101277562 12:103219066-103219088 CTGTTCATTCCCCTGGAAAGGGG + Intergenic
1101472686 12:105013468-105013490 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1101488025 12:105185246-105185268 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1101601269 12:106212379-106212401 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1102182614 12:110923764-110923786 CTGTTTCCTCACCTGGAAAAGGG + Intergenic
1102430326 12:112878105-112878127 CTGTGCACTCCCATGGATCATGG + Intronic
1104115625 12:125746534-125746556 CTGCTCACTCCCCTGGAAAGGGG - Intergenic
1106335104 13:28776872-28776894 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1106336048 13:28784168-28784190 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1106391187 13:29337131-29337153 CTGTTCACCCCCCTGGAAAGGGG - Intronic
1106429402 13:29665725-29665747 CTGTTCACTCTCCTGGAAAGGGG + Intergenic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1106612333 13:31295803-31295825 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1106650839 13:31688397-31688419 CTTTTCACTCCCCTGGAAAGGGG + Intergenic
1106731823 13:32549382-32549404 CTGTTAACTTTCCTGGATAAGGG + Intergenic
1107098340 13:36560682-36560704 CAGGTTACTCCGCTGGAACATGG + Intergenic
1107551500 13:41480293-41480315 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1107648146 13:42516435-42516457 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1108030104 13:46220590-46220612 CTGTTCACTACCCTGGAAAGGGG - Intronic
1108236809 13:48416587-48416609 CTGTTAACTCCCCTGGAACAGGG + Intronic
1108304582 13:49118507-49118529 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1108890864 13:55257471-55257493 ATTTTACCTCCCCTGGCACATGG - Intergenic
1109195904 13:59377278-59377300 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1109232384 13:59774429-59774451 CTGTAAACTCCACTGGGATAAGG + Intronic
1109731525 13:66419815-66419837 CTGTTCACTACCCTGGAAAGGGG + Intronic
1110890264 13:80689746-80689768 CTCTTCACTCCCCTGGAAAGGGG + Intergenic
1110942005 13:81362696-81362718 CTGTTTATTCCCCTGGAAAGGGG + Intergenic
1111627927 13:90813345-90813367 CCGTTTACTCCCCTGGAAAAGGG + Intergenic
1112231588 13:97593372-97593394 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1113131584 13:107042921-107042943 CCGTTCACTCCCCTGGAAAAGGG - Intergenic
1113698171 13:112363830-112363852 TCTTTAACTCCCCTGGAAAAGGG + Intergenic
1114130897 14:19790677-19790699 ATGTAAAATCCCCAGGAACAGGG + Intronic
1114133585 14:19820918-19820940 CTATTCACTCCCCTGGAAATGGG - Intronic
1114695506 14:24623703-24623725 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1115124168 14:29972479-29972501 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1115277092 14:31621269-31621291 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1115721116 14:36162197-36162219 CTGTTCACTCCCCTGGAAAGAGG - Intergenic
1115842770 14:37490439-37490461 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1116272896 14:42795060-42795082 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1116377367 14:44220546-44220568 CTGTTACCTACCATGTAACAGGG + Intergenic
1116775699 14:49178628-49178650 CTGTTCATTCCCCTGGAAACGGG + Intergenic
1117121041 14:52568455-52568477 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1117441908 14:55767858-55767880 CTGGTATCTCCCTTGAAACACGG - Intergenic
1117828263 14:59726012-59726034 GTGTTCTCTCCCCAGGAACAGGG + Intronic
1118544693 14:66873414-66873436 CTGTTAACTCCCCTGGAAAGGGG + Intronic
1118910383 14:70057391-70057413 CTCTGATCTCCCCTGGAACTTGG - Intronic
1119018506 14:71084835-71084857 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1119504010 14:75155954-75155976 CAGTTTCCTCCCATGGAACACGG - Intronic
1120770096 14:88370022-88370044 CCGTTCACTCCTCTGGAAAAGGG + Intergenic
1120843181 14:89104811-89104833 CAGTTCACTCCCCTGGAAAGGGG - Intergenic
1121631900 14:95427317-95427339 CTCTAAACTCCCCTGGGAAAAGG - Intronic
1121694821 14:95904136-95904158 TAGTTCACTCCCCTGTAACATGG + Intergenic
1122660208 14:103290143-103290165 CTGTTGACTCACCAGGAGCAGGG + Intergenic
1123573949 15:21646305-21646327 ATGTAAAATCCCCAGGAACAGGG + Intergenic
1123610565 15:22088890-22088912 ATGTAAAATCCCCAGGAACAGGG + Intergenic
1123626413 15:22229814-22229836 CTCTCAACTCCCCTGGAATTGGG + Intergenic
1125288497 15:38119874-38119896 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1125302944 15:38276567-38276589 CTGTTTGCTCACCTGAAACATGG - Intronic
1125784270 15:42301505-42301527 CTCTTCACTCCCCTGGAAAGGGG + Intronic
1126500574 15:49340105-49340127 CAGTTCACTCCCCTGGAAAGGGG - Intronic
1127029999 15:54851186-54851208 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
1127147734 15:56042189-56042211 CTGTTAAATCCCCTGACACAAGG + Intergenic
1127317899 15:57815084-57815106 CCGTTGACTCCCCTGGAAAGGGG - Intergenic
1127332391 15:57951718-57951740 GTGTTAACACCCCAGAAACAAGG - Intergenic
1127536620 15:59895766-59895788 ATTTTAACTCTTCTGGAACAGGG - Intergenic
1127719287 15:61683949-61683971 CTCTTAACTCACCTGCAAAATGG - Intergenic
1128618346 15:69127958-69127980 CTGTAAACTCCACTGGGGCAGGG + Intergenic
1128857543 15:71031982-71032004 CCGTTCACTCCCCTGGAAAGCGG - Intronic
1128883649 15:71265607-71265629 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1129126743 15:73448150-73448172 CTGTTCACTCCCCTGAAAAGGGG + Intronic
1129495614 15:75977310-75977332 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1130204708 15:81865393-81865415 CTGTTCTCTCCCATGGAACGGGG - Intergenic
1131384461 15:91992073-91992095 CTGTGAACTCCTGTGGCACAGGG - Intronic
1132301273 15:100777398-100777420 CTGTTATCTCCCTGGGAGCACGG + Intergenic
1202982813 15_KI270727v1_random:380645-380667 ATGTAAAATCCCCAGGAACAGGG + Intergenic
1132523436 16:401872-401894 CTGCGAACTCGCCTGGAACCGGG - Exonic
1133749844 16:8716138-8716160 CTGTTTTCTCCACTGGAAAATGG - Intronic
1135807534 16:25556292-25556314 CAGTTCACTCCCCTGGAAAGTGG + Intergenic
1137296293 16:47097174-47097196 CTGTTCATTCCCCTGGAAAGGGG + Intronic
1137336502 16:47554505-47554527 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1137970013 16:52975556-52975578 CCGTTCACTCCCCTGGAAATGGG - Intergenic
1139069538 16:63363521-63363543 CTGTTTACTCCCTTGGAAGCAGG - Intergenic
1139267085 16:65650017-65650039 CTCTCAACTCCCCTGCAAAAGGG + Intergenic
1140165211 16:72543658-72543680 CTGTTCACTCCCATGGAAAGGGG + Intergenic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1140711809 16:77685774-77685796 CTGTCACATCCCATGGAACATGG + Intergenic
1141246136 16:82309401-82309423 CTGTTCACTCTCCTGGAAAGGGG - Intergenic
1141602271 16:85134033-85134055 CTGTCAGATCCCCTGGGACAGGG + Intergenic
1141815927 16:86409224-86409246 CTGTCATCACCCCTTGAACATGG + Intergenic
1142682686 17:1559663-1559685 CTGTTTACTAGCCTGGAGCAAGG - Intronic
1142830939 17:2548615-2548637 CTGTGCACTCCCCTGGAACTGGG + Intergenic
1145258822 17:21342731-21342753 CTGTTTTCTCCCCTGTAAAATGG - Intergenic
1145317802 17:21745273-21745295 CTGTTTTCTCCCCTGTAAAATGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147525239 17:41216319-41216341 CTGTTCACTACCCTGGAAAGGGG + Intronic
1147731398 17:42605607-42605629 CTGTTAAGTCCCCAGAAACTTGG - Intronic
1148403270 17:47386621-47386643 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1148981013 17:51574859-51574881 CTGTTCACTCCACTGGAAAGGGG + Intergenic
1150545752 17:66155548-66155570 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1151392875 17:73799566-73799588 CTGTGGGCTCCCCTGGAACAGGG - Intergenic
1152056133 17:78028329-78028351 TTGTTGACACCACTGGAACAAGG + Intronic
1152891309 17:82883169-82883191 CTGTCAACTTCCCTGGAACAAGG + Intronic
1153119161 18:1700412-1700434 CTGTTTACTCCTCTGGAAAGAGG + Intergenic
1153702588 18:7711484-7711506 CCATTCACTCCCCTGGAAAAGGG + Intronic
1153717875 18:7869185-7869207 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1154101570 18:11479420-11479442 CTGTTCACTCACCTGGAAAGGGG - Intergenic
1154505471 18:15036181-15036203 GTGTTAACTTTCCTGGATCACGG + Intergenic
1156979310 18:43265803-43265825 TTGTTTACTCCCCTGGAAAGGGG - Intergenic
1157066585 18:44357168-44357190 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1157392041 18:47311088-47311110 CTGTTAATTCCCTGGGGACAAGG - Intergenic
1157695128 18:49716442-49716464 CAGTTCACTCCCCTGGAAAAGGG - Intergenic
1158373148 18:56831992-56832014 CCGTTCACTCCCCTGGAAAGAGG + Intronic
1158399057 18:57104466-57104488 CTGTTCACTCCTCTGGAAAGGGG - Intergenic
1158853348 18:61517771-61517793 CCATTCACTCCCCTGGAAAAGGG + Intronic
1159690617 18:71482997-71483019 CCATTCACTCCCCTGGAAAACGG - Intergenic
1164093015 19:21977734-21977756 CCGTTCACTCCCCTGGAAAGAGG + Intronic
1165254614 19:34568204-34568226 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1167974147 19:53210291-53210313 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
1202696155 1_KI270712v1_random:128125-128147 CTGTCAACTTCACTGGAAGAAGG + Intergenic
925031299 2:651982-652004 CTGTTAATTCCCATGGCTCAAGG - Intergenic
925692321 2:6537822-6537844 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
926483477 2:13427794-13427816 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
928488258 2:31754487-31754509 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
930476678 2:51891374-51891396 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
931479157 2:62622256-62622278 CTGTTCACTCCCCTGGAAGGGGG - Intergenic
931480368 2:62633438-62633460 CCGTTCACTCCCCTGGAAGGGGG + Intergenic
933317854 2:80736852-80736874 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
933355619 2:81206222-81206244 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
933488309 2:82950533-82950555 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
934692188 2:96370308-96370330 CTGTCAACTCCCCAGGAGGAGGG + Intronic
934702708 2:96454853-96454875 CTGTTCAATCCCCTGGAAAGGGG + Intergenic
935399414 2:102644466-102644488 CTGTTCACTCCCCTGGAAAGGGG + Intronic
935961466 2:108429596-108429618 CCGTTCACTCCCCTGGAAAAAGG + Intergenic
936388226 2:112049571-112049593 CTCTAAACTCCCCTGGAGAAAGG - Intergenic
936448350 2:112614880-112614902 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
937465047 2:122125119-122125141 CTGTTCACTCCCCTGGAAGGGGG - Intergenic
937562700 2:123244913-123244935 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
937573490 2:123391826-123391848 TTGTTCACTCCCCTGGAAAGGGG + Intergenic
937807262 2:126160924-126160946 CTGTTCACTCTCCTGGAAAGGGG + Intergenic
939652782 2:144785429-144785451 CTGTTTGCTCCCCTGGAAAGGGG + Intergenic
939876717 2:147586447-147586469 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
939937787 2:148313629-148313651 CCGTTCACTCCCCTGGAAAGGGG - Intronic
940030578 2:149257638-149257660 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
940114387 2:150192328-150192350 CCATTAACTCACCTGGAAAAGGG + Intergenic
940370535 2:152896028-152896050 CTGTTTACTCCTCTGGAAAGGGG + Intergenic
940964500 2:159822186-159822208 CTGTTCACTCCCCTGGAAAGGGG + Intronic
941076349 2:161010440-161010462 CTGTTCACTCCCCTGGAAAAGGG + Intergenic
941478026 2:165971935-165971957 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
941565373 2:167099498-167099520 CTGTTCACTCTCCTGGAAAGGGG - Intronic
941571536 2:167176106-167176128 CCGTTCACTCCCCTGGAAAGGGG - Intronic
942722208 2:178965769-178965791 CTCTTCACTCCCCTGGAAAGGGG + Intronic
942898727 2:181089371-181089393 CTGTTCACTCCCTTGGAAAGGGG + Intergenic
943085026 2:183300792-183300814 CCATTCACTCCCCTGGAAAAAGG - Intergenic
943094864 2:183416756-183416778 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
943350687 2:186793155-186793177 CTGTTCGCTCCCCTGGAAAGGGG + Intergenic
943352501 2:186812239-186812261 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
943408788 2:187520137-187520159 CTGTTCACTCCCCTGGAAAGGGG - Intronic
944292011 2:198018383-198018405 CCGTTCACTCCCCTGGAATAGGG + Intronic
944635388 2:201671219-201671241 CCGTTTGCTCCCCTGGAAAAGGG + Intronic
944764327 2:202849284-202849306 CCGTTCACTCCCCTGGAAAGGGG + Intronic
944838138 2:203599832-203599854 CAGTTAACTCATCTGCAACATGG + Intergenic
945210914 2:207381175-207381197 CTGTCCACTCCCCTGGAAAGGGG - Intergenic
945896304 2:215486214-215486236 CTGTTTTCTCCCCTTGAACCTGG + Intergenic
946052862 2:216878703-216878725 CTGATATATGCCCTGGAACAAGG + Intergenic
946065341 2:216982686-216982708 CTGTTCACTCCCCTGGAAAGAGG - Intergenic
947086027 2:226454096-226454118 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
947341799 2:229148419-229148441 CTCCTGACTCCACTGGAACAAGG + Intronic
947681445 2:232037523-232037545 CTGTTCACCCCGCTGGAAAAGGG - Intronic
1169397067 20:5241708-5241730 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1169960365 20:11152749-11152771 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1170167924 20:13381064-13381086 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1170229419 20:14028410-14028432 CTGTTCATTCCCCTGGAAAGGGG - Intronic
1170266406 20:14470912-14470934 CTGTTCACTTCCCTGGAAAGGGG - Intronic
1172603865 20:36201553-36201575 CTCTGAACTCCCCTGGAGCTTGG + Intronic
1174204920 20:48831327-48831349 CTGCTTAGTCCCCTGGCACAAGG + Intergenic
1174360773 20:50027778-50027800 CAGTTTCCTCCCCTGGAAAATGG + Intergenic
1174730199 20:52908629-52908651 CTGTTCACAGCCCTGGAGCAGGG - Intergenic
1176792387 21:13332935-13332957 GTGTTAACTTTCCTGGATCATGG - Intergenic
1176891762 21:14327317-14327339 CTGTTCCCTCCCCTGGAAAGGGG + Intergenic
1177050259 21:16224755-16224777 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG + Intergenic
1177861284 21:26457602-26457624 CTGTAAACTCCCTGAGAACAGGG - Intergenic
1178864471 21:36316664-36316686 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1179557313 21:42187990-42188012 CAGTTACCTCACCTGGAAAATGG + Intergenic
1181559348 22:23691030-23691052 CGGTTGGCTCCTCTGGAACAGGG + Exonic
1182112660 22:27734389-27734411 CTGTTTCCTTCCCTGGAAAATGG + Intergenic
1182952520 22:34390799-34390821 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
1183012418 22:34957821-34957843 CTATTCTCTCCCCTGGAACTGGG - Intergenic
1183182738 22:36271883-36271905 CCGTTCACTCCCCTGGAAAGAGG - Intergenic
1183919972 22:41157948-41157970 CTGTTAACTCATCTGGAGTAGGG + Intronic
949173904 3:1035115-1035137 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
949175971 3:1063183-1063205 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
949226947 3:1705836-1705858 CCATTCACTCCCCTGGAAAAGGG + Intergenic
949580632 3:5384264-5384286 CTGTTCACTCCCCTGGAAAGAGG - Intergenic
950221075 3:11196575-11196597 CTGTTTACTCACCTAGCACATGG + Intronic
950562002 3:13736364-13736386 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
950712996 3:14827108-14827130 CTGTTTTCTCACCTGGAAAATGG - Intronic
951503699 3:23418046-23418068 CCGTTCACTCCCCTGGAAAAGGG - Intronic
951629139 3:24699457-24699479 CAGTTCACTCCCCTGGAAAGGGG - Intergenic
951676459 3:25247309-25247331 CAGTTCATTCCCCTGGAAAAGGG - Intronic
951687619 3:25362462-25362484 CCGTTCACTCCCCTGGAAAGGGG - Intronic
951741649 3:25931621-25931643 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
951777277 3:26324065-26324087 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
952077746 3:29718609-29718631 GTGTTAACTCCCCTGCAACTTGG + Intronic
953047211 3:39304680-39304702 CTGTTCTCTCCCCTGGAAAGGGG + Intergenic
953102376 3:39842448-39842470 CCGTTCACTCCCCTGGAAAGGGG - Intronic
953555807 3:43946047-43946069 CCATTCACTCCCCTGGAAAAGGG - Intergenic
954507621 3:51092162-51092184 CTGTTCACTCCTCTGGAAAGGGG + Intronic
954524925 3:51261564-51261586 CCGTTCACTCCCCTGGAAAGGGG + Intronic
955175133 3:56606264-56606286 CTGTTCACTCTCCTGGAAAGGGG - Intronic
956157357 3:66312471-66312493 CTGTTTACTCCCATGGAAAGGGG - Intronic
956355695 3:68390006-68390028 CCGTTCACTCCCCTGGAAAGGGG + Intronic
957249643 3:77756896-77756918 CCATTCACTCCCCTGGAAAAAGG + Intergenic
958434548 3:94080896-94080918 CAGTTCACTCCCCTGGAAAGGGG - Intronic
958520939 3:95184741-95184763 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
959505892 3:107156157-107156179 CTGTTCTCTCCCCTGGAAAGGGG + Intergenic
959534585 3:107470512-107470534 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
959881224 3:111447094-111447116 CCGTTCACTCTCCTGGAAAAGGG - Intronic
960075947 3:113485231-113485253 CTGTTCACTCCCCTGGAAAGGGG + Intronic
960579808 3:119267326-119267348 CCGTTCACTCCCCTAGAAAAGGG + Intergenic
960763334 3:121097298-121097320 CCGTTCACTCCCCTGGAAAGGGG - Intronic
960827862 3:121811418-121811440 CTGTTCACTCCCCTGGAAAGGGG + Intronic
961977492 3:131042263-131042285 CTGTTCACTCCCCTGGAAAGGGG + Intronic
963027420 3:140933536-140933558 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
963629316 3:147713149-147713171 CTGCTCACTCCCCTGGAAAGGGG - Intergenic
963751413 3:149183493-149183515 CTTTTCTCTCCACTGGAACACGG + Exonic
963976299 3:151483954-151483976 CTGTTCACTCCCCTGGAAGGGGG + Intergenic
963980208 3:151528855-151528877 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
963998584 3:151739999-151740021 CCGTTCACTCCCCTGGAAAGGGG - Intronic
964053073 3:152419764-152419786 CCGTTCACTCCCCTGGAAAGAGG + Intronic
964560440 3:157989491-157989513 CTGGTCCCTCCCATGGAACATGG + Intergenic
964608743 3:158587603-158587625 ATGTAATCTCCCCTTGAACATGG + Intronic
964649121 3:158991550-158991572 CTGTTCACTCCCCTGGAAAGGGG - Intronic
965511081 3:169568370-169568392 CTGTTCACTCCCCTGGAAAAGGG + Intronic
965618751 3:170621643-170621665 CCGTTCACTCCCCTGGAAAGAGG - Intronic
965801328 3:172496901-172496923 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
966251055 3:177865860-177865882 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
966309383 3:178576494-178576516 CTGTTCACTCTCCTGGAAAGGGG + Intronic
966533326 3:181004497-181004519 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
967143113 3:186580472-186580494 CTGTTACCTCACCTGTAAAATGG + Intronic
967181524 3:186909525-186909547 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
967343563 3:188427900-188427922 CCGTTCACTCCCCTGGAAAGGGG - Intronic
967562686 3:190935008-190935030 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
967715558 3:192758198-192758220 CGGTTCACTCCCCTGGAAAGGGG + Intronic
968041447 3:195592518-195592540 CTGTTATCTCCCCCAGAAGATGG - Intergenic
968404736 4:330127-330149 CTCTAAACTCCCCTGGGAAAAGG + Intergenic
968559147 4:1267994-1268016 CTCTAAACTCCCCTGGGAAAAGG + Intergenic
970185392 4:13446356-13446378 CTGTCCACTCCCCTGGAAAGGGG - Intronic
970412022 4:15818005-15818027 CTGTTCACTCCCCTGGAAAGGGG + Intronic
970679349 4:18489320-18489342 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
971150717 4:24028682-24028704 CTGTTCCCTCTCCTGCAACATGG + Intergenic
971264018 4:25082417-25082439 TTGTTAACTCCCCAGTACCAAGG + Intergenic
971647661 4:29229766-29229788 CCGTTGACTCCCCTGGAAAGGGG + Intergenic
973272977 4:48280065-48280087 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
973321795 4:48817579-48817601 TTGTTTACTCCCCTGGAAAGGGG + Intronic
973562623 4:52151650-52151672 CCATTCACTCCCCTGGAAAAGGG + Intergenic
973629082 4:52802110-52802132 CTGTTCACTCCCCTAGAAAGGGG + Intergenic
973660877 4:53105338-53105360 CCGTTCACTCCCCTGGAAAGGGG + Intronic
973837469 4:54824850-54824872 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
974326327 4:60419349-60419371 CTGTTCACTGCCCTGGAAAGGGG - Intergenic
974491650 4:62571902-62571924 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
975233599 4:71964482-71964504 CTTTTAACTCACCTTTAACATGG + Intergenic
975524223 4:75331451-75331473 CCATTCACTCCCCTGGAAAAGGG + Intergenic
975620356 4:76290625-76290647 CTGTTCACTCTCCTGGAAAGAGG - Intronic
975638762 4:76478129-76478151 TTGTTCACTCCCCTGGAAAGGGG + Intronic
976438266 4:85043797-85043819 CCATTCACTCCCCTGGAAAAGGG + Intergenic
976715914 4:88122317-88122339 CTGTTCACTCCCCTGGAAAAGGG + Intronic
976809958 4:89090014-89090036 CTGTTCACTCCCCTGGAAAGGGG - Intronic
976861479 4:89671578-89671600 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
977467784 4:97403346-97403368 CTGCTTACTCCCCTGGAAAGGGG - Intronic
977986151 4:103385547-103385569 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
978090264 4:104707004-104707026 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
978313260 4:107409442-107409464 CTGTTCACTCCTCTGGAAGGGGG + Intergenic
978723655 4:111945116-111945138 CTGTTTACTCTCCAGTAACATGG + Intergenic
978845587 4:113269263-113269285 CGGTTCACTCCCCTGGAAAGGGG - Intronic
978906657 4:114013156-114013178 CTGTTCACTCCCTTGGAAAGGGG - Intergenic
979012301 4:115387399-115387421 CTGTTCACTCCCCTGGAAAGAGG + Intergenic
979043658 4:115834409-115834431 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
979417433 4:120460808-120460830 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
979457570 4:120944219-120944241 CAGTTCACTCCCCTGGAAAGGGG + Intergenic
980100341 4:128535856-128535878 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
980200577 4:129651703-129651725 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
980330412 4:131403573-131403595 CAGTTCACTCCCCTGGAAAGGGG - Intergenic
980583667 4:134786594-134786616 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
980733257 4:136848947-136848969 CTGTTCACTCCCCTAGAAAGGGG - Intergenic
981131555 4:141162955-141162977 TTGTTCACTCCCCTGGAAGGGGG + Intronic
981481497 4:145243469-145243491 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
981788007 4:148502867-148502889 CCGTTCACTCCACTGGAAAAAGG - Intergenic
981846494 4:149176001-149176023 CTGTTCACTCCCCTGCAAAGGGG + Intergenic
981885312 4:149666579-149666601 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
982068781 4:151676793-151676815 CTCTTAACTCCCCTGGCTCTGGG + Intronic
982091043 4:151880224-151880246 CTGTTAAGTCCTCTGGACCCTGG + Intergenic
982323851 4:154108933-154108955 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
982693655 4:158575374-158575396 CTGTTAACAACCCATGAACATGG - Intronic
982725630 4:158902973-158902995 CGGTTCACTCCCCTGGAAAGGGG - Intronic
982733392 4:158979853-158979875 CTGTTCACTCCTCTGGAAAGGGG + Intronic
982852985 4:160342463-160342485 TTGTTCACTCCCATGGAAAAGGG - Intergenic
982909248 4:161118235-161118257 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
983047503 4:163004708-163004730 ATGTTCACTCCCCTGGAAAGGGG - Intergenic
983167721 4:164497705-164497727 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
983299053 4:165902232-165902254 CTGTTCACTCCCCTGGAAAGGGG - Intronic
983331410 4:166333729-166333751 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
983485920 4:168331352-168331374 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
983602774 4:169548957-169548979 CTGTTCACTCCCCTAGAAAGGGG - Intronic
983788039 4:171759278-171759300 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
983896248 4:173084801-173084823 TTGTTCACTCCCCTGGAAAGGGG - Intergenic
983949475 4:173622542-173622564 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
983984260 4:174039130-174039152 CTGTTAACGCTACTGGTACAGGG + Intergenic
987290955 5:16507763-16507785 CTGGTAACTCTCTAGGAACAAGG - Intronic
987391669 5:17381923-17381945 CTATTCTCTCCCCTTGAACATGG + Intergenic
987528227 5:19080661-19080683 CCGTTCACTCCTCTGGAAAAGGG - Intergenic
988289784 5:29270484-29270506 CTGTTCACTTCCCTGGAAATGGG + Intergenic
988409296 5:30865600-30865622 CTGTTAGCTCCTCGTGAACAGGG - Intergenic
988618189 5:32795162-32795184 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
988719184 5:33859160-33859182 CTGTTCACTTCCCTGGAAAGGGG + Intronic
988970761 5:36465386-36465408 CTGTTCGCTCCCCTGGAAAGAGG + Intergenic
989320737 5:40131040-40131062 CTGTTCACTCCCTTGGAAAGGGG - Intergenic
989619070 5:43367220-43367242 CTGTTCACTACCCTGGAAAGGGG - Intergenic
990098835 5:52156794-52156816 CTATTTACTCCCCTGGAAAGGGG + Intergenic
990351301 5:54919255-54919277 CTGTTCACTCCCCTGGACAGGGG + Intergenic
990673907 5:58162309-58162331 CCATTCACTCCCCTGGAAAAGGG - Intergenic
990897617 5:60715904-60715926 GTCTTCACTCCCCTGGAAAAGGG - Intergenic
991026693 5:62037635-62037657 CTGTTCACTCTCCTGGAAAGGGG - Intergenic
991110766 5:62896824-62896846 CCGTTCACTCCCCTGGAAAGAGG - Intergenic
991223549 5:64243241-64243263 CCGTTCACTCCCCTGGAAAGGGG + Intronic
993381880 5:87217857-87217879 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
993541604 5:89159331-89159353 CTGGTTACTCCCCTGGAAAGGGG + Intergenic
993894964 5:93523001-93523023 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
993911526 5:93690205-93690227 CCGTTCAATCCCCTGGAAAAGGG + Intronic
994005184 5:94828929-94828951 CTGTTTACTCCCCTGGAAAGGGG - Intronic
994015021 5:94955418-94955440 CTGTTCACTCCCCTGGTAAGGGG + Intronic
994142883 5:96361319-96361341 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
994438095 5:99763784-99763806 CCGTTCACTCCCCTGGAAAAAGG - Intergenic
994991338 5:107000246-107000268 CTGTTCACTCCCCTGGAAAAAGG - Intergenic
995464397 5:112436137-112436159 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
995475018 5:112539107-112539129 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
995790679 5:115883192-115883214 CCGTTCACTCCCCTGGAAAGGGG - Intronic
995808536 5:116080330-116080352 CTGTTTACTCCCGTGGAAAGGGG + Intergenic
996129916 5:119769680-119769702 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
996242489 5:121221069-121221091 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
996270754 5:121602204-121602226 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
996324093 5:122252703-122252725 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
996426644 5:123320316-123320338 CCATTCACTCCCCTGGAAAAAGG - Intergenic
996427942 5:123335335-123335357 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
997214188 5:132096747-132096769 CTGTCAAATGCCCTGGGACAGGG + Intergenic
998780174 5:145647510-145647532 CCGTTCACTCCCCTGGAAAGGGG - Intronic
998783689 5:145686002-145686024 CTGTTCATTCCCATGTAACATGG - Intronic
998861521 5:146448148-146448170 CTGTTATCTCACCTGTAAGATGG - Intronic
998927515 5:147142540-147142562 CTGTTTATTCCCCTGGAAAGGGG - Intergenic
998972811 5:147611172-147611194 CCGTTCACTCCCCTGGAAAGGGG - Intronic
999030096 5:148281272-148281294 CTGTTCACTCACCTGGAAAGGGG - Intronic
999093614 5:148958694-148958716 CTGCTTTCTCCCCTGGCACATGG - Intronic
999488736 5:152026995-152027017 CTGTTCACTCCCCTGAAAAAAGG - Intergenic
999489857 5:152039286-152039308 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
999688296 5:154122307-154122329 TTGTTCACTCCCCTGGAAAGGGG + Intronic
1000376144 5:160584017-160584039 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1000860442 5:166450515-166450537 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1000996127 5:167960685-167960707 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1001346529 5:170905137-170905159 CTGAAAACTCCCCTTGTACAGGG - Intronic
1002944776 6:1750724-1750746 CCGTTCACTCCCCTGGAAAGAGG + Intronic
1004027967 6:11837340-11837362 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1004049832 6:12065615-12065637 CTGTTTGCTCCTCTGGAAAATGG + Intronic
1005208569 6:23432808-23432830 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1005274161 6:24198659-24198681 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1005376314 6:25186022-25186044 CTGTTTACTCCCCTGGAAAGGGG - Intergenic
1005795739 6:29359926-29359948 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1006198403 6:32263283-32263305 CCGTTCACTCCCCTGGAAAGAGG - Intergenic
1006460791 6:34156578-34156600 CTGTTAACGGACCTGGAATAGGG - Intergenic
1007031746 6:38634440-38634462 CTGTAAACTTCCCAGGAACAGGG + Intronic
1008299543 6:49818264-49818286 ATCTTAACTCCCCAGGAATAAGG + Intergenic
1008575493 6:52856541-52856563 TTGTTCACTCCCCTGGAAAGGGG - Intronic
1008758431 6:54824997-54825019 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1008764991 6:54901256-54901278 CTGTAAACTCCAGTGGGACAGGG + Intronic
1009305925 6:62089209-62089231 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1009336035 6:62492172-62492194 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
1009455244 6:63848835-63848857 CTGTTCACTCCTCTGGAAAGGGG + Intronic
1009945386 6:70336614-70336636 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1010006204 6:70998141-70998163 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1010447027 6:75959853-75959875 CTGTTCACTCCCCTGGAAAAGGG - Intronic
1010574923 6:77518663-77518685 CTATTCACTCCCCTGGAAAGGGG + Intergenic
1010615346 6:78005778-78005800 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1010668333 6:78655815-78655837 CCATTCACTCCCCTGGAAAAGGG - Intergenic
1010780254 6:79937511-79937533 CAGTTTACTCACCTGGAAAATGG + Intronic
1010993983 6:82512431-82512453 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1011301470 6:85878896-85878918 CTGTTCATTCCCCTGGAAAGGGG - Intergenic
1011318713 6:86065775-86065797 CTGTTCACTGCCCTGGAAAGGGG - Intergenic
1011333640 6:86236667-86236689 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1011398629 6:86936956-86936978 CTGTAATCTCCCCTGGAGGAGGG + Intergenic
1011766244 6:90623263-90623285 CTGTTCACTTCCCTGGAAAGGGG + Intergenic
1012343500 6:98157141-98157163 CTGTTTACTCCCCTGGAAAGGGG - Intergenic
1012674738 6:102100905-102100927 CTGTTCACTCTCCTGGAAAGAGG + Intergenic
1012922443 6:105233992-105234014 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1013037968 6:106405035-106405057 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1013390212 6:109679108-109679130 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1013452969 6:110303316-110303338 CCATTCACTCCCCTGGAAAAGGG + Intronic
1013920173 6:115394585-115394607 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1014122853 6:117746178-117746200 CCGTTTACTCCCCTGGAAAGAGG + Intergenic
1014387090 6:120816182-120816204 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1014466302 6:121760653-121760675 CAGTTCACTCCCCTGGAAAGGGG + Intergenic
1014569020 6:122986342-122986364 CTGTTTACTCCACTGGAAAGGGG + Intergenic
1014753675 6:125280390-125280412 CTGTTCACTCCCCTAGAAAGGGG + Intronic
1014968185 6:127782286-127782308 CTGTTCACTCCCCTGGAATGAGG - Intronic
1015500741 6:133930838-133930860 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1015623424 6:135156324-135156346 CTGTTCACTCCCCAGGAAAGGGG - Intergenic
1015883304 6:137891382-137891404 CCATTCACTCCCCTGGAATAGGG - Intergenic
1016542143 6:145178100-145178122 CCCTTCACTCCCCTGGAAAAGGG + Intergenic
1016590858 6:145742070-145742092 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1016638732 6:146324381-146324403 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1016717529 6:147251442-147251464 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1016818397 6:148324854-148324876 CTGCTAACTCACCCGGAACTGGG + Intronic
1017322601 6:153111094-153111116 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1018094547 6:160373996-160374018 CTGTTCTCTCCCCTGGAAAGGGG - Intronic
1018108689 6:160513840-160513862 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1018797667 6:167199864-167199886 CTGTTCACTCCCCTGCAAAGGGG - Intergenic
1020333384 7:7042288-7042310 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1020367255 7:7393917-7393939 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1020428615 7:8096378-8096400 CTATTCACTCCCCTGGAAAGGGG + Intergenic
1020608619 7:10367725-10367747 CTGTTCACTTCCCTGGAAAGGGG - Intergenic
1020635953 7:10696035-10696057 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1020694021 7:11392534-11392556 CTATTCACTCCCCTGGAAAGGGG + Intronic
1020716034 7:11675416-11675438 CGGTTCACTCCCCTGGAAAGAGG + Intronic
1020884330 7:13803559-13803581 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1021207830 7:17807107-17807129 CCGTTCACTCCCCTGGAAAGAGG + Intronic
1022058874 7:26770443-26770465 CTGTTCATTCCCCTGGAAAAGGG - Intronic
1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG + Intronic
1022615605 7:31926963-31926985 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1022869087 7:34457368-34457390 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1024017694 7:45332984-45333006 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1024152951 7:46591180-46591202 CTGTTCACTTCCCTGGAAAGGGG + Intergenic
1024664930 7:51536751-51536773 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1025637957 7:63340115-63340137 CTGTTCACTCCCCTGGAAAGAGG - Intergenic
1025644739 7:63407984-63408006 CTGTTCACTCCCCTGGAAAGAGG + Intergenic
1025714372 7:63941400-63941422 CAGTTTACTCCCCTGGAAAGGGG + Intergenic
1026579558 7:71602641-71602663 CTGTCACCTCCCCTGCCACATGG - Intronic
1027552762 7:79619498-79619520 CTGTTACCTTCACTGGACCAAGG - Intergenic
1027637061 7:80689194-80689216 CCGTTCACTCCACTGGAAAAGGG + Intergenic
1027843331 7:83341776-83341798 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1028429985 7:90735813-90735835 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1028476356 7:91257864-91257886 CTGTTCACTCCCCTAGAAAGGGG - Intergenic
1028627988 7:92898703-92898725 CTGTTCACTCCCCTGGAAAAAGG - Intergenic
1028630295 7:92926675-92926697 CAGTTCACTCCCCTGGAAAGGGG - Intergenic
1028648179 7:93121028-93121050 CTGTTCACTCCCCTGAAAAGGGG + Intergenic
1029324786 7:99796712-99796734 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1029816950 7:103106402-103106424 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1030141057 7:106304455-106304477 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1030500841 7:110356771-110356793 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
1030703103 7:112662550-112662572 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1031397760 7:121293493-121293515 CTGTTCACTCCCTTGGAAACGGG - Intronic
1031630424 7:124037116-124037138 CTGGTACAACCCCTGGAACAAGG + Intergenic
1031710979 7:125046453-125046475 CAGTTCACTCCCCTGGAAAAGGG + Intergenic
1031717316 7:125125206-125125228 CCGTTCACTCCCCTGGAAAAAGG - Intergenic
1032604085 7:133330413-133330435 CCGTTCACTCCCCTGGAAAGGGG - Intronic
1032883542 7:136115117-136115139 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1032893287 7:136222626-136222648 CTGTTCATTCCCCTGGAAAGGGG + Intergenic
1032957142 7:136984428-136984450 CTGTTCACTTCCCTGGAATGGGG - Intronic
1032966425 7:137103541-137103563 CCGTTCACTCCCCTGGAAAGAGG + Intergenic
1034370801 7:150594731-150594753 CTGTTCACTCCCCTAGAAAGGGG - Intergenic
1034558237 7:151863221-151863243 CTGGTAAATCCCCAGGTACAGGG + Intronic
1034558247 7:151863248-151863270 CTGGTAAGTCCCCGGGTACAGGG + Intronic
1034559034 7:151867930-151867952 CAATGAACTCCCCTGGAAGAAGG + Intronic
1034715135 7:153234984-153235006 CTGTTCACTCCTCTGGATAAAGG - Intergenic
1035710726 8:1712028-1712050 CCGTTCACTCTCCTGGAAAAGGG + Intergenic
1035776977 8:2195896-2195918 CTGATAGCCCCCATGGAACAGGG + Intergenic
1035998341 8:4574111-4574133 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1038936474 8:32257273-32257295 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1040473880 8:47760112-47760134 CTGTTCACTCCCCTAGAAAGGGG - Intergenic
1040818391 8:51532757-51532779 CCTTTCACTACCCTGGAACATGG + Intronic
1041459768 8:58098532-58098554 CCGTTCACTCCCCTGGAAACGGG - Intronic
1041630595 8:60082923-60082945 CTGTTCACTGCCCTGGAAAGGGG - Intergenic
1043118175 8:76286542-76286564 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1043366342 8:79537428-79537450 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1044595285 8:93953258-93953280 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1044940279 8:97335128-97335150 CTGTTCACTCGCCTGGAAAGGGG - Intergenic
1045212088 8:100108821-100108843 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1045883217 8:107065173-107065195 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1046277786 8:111985729-111985751 CTGTTCATTCCCCTGGAAAGGGG + Intergenic
1046947496 8:119988006-119988028 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1047121277 8:121908072-121908094 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1048288282 8:133159714-133159736 CTGGTCCCTCCCCTGAAACATGG - Intergenic
1049240331 8:141534637-141534659 CTGTCTTCTCCTCTGGAACATGG + Intergenic
1049872395 8:144990801-144990823 CTATTCACTCCCCTGGAAAGGGG - Intergenic
1049964578 9:766897-766919 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1050031739 9:1393528-1393550 CCGTTCACTCCCCTGGAAACGGG + Intergenic
1050404464 9:5293228-5293250 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1050637385 9:7626656-7626678 CCGTTCACTCCCCTGGAAGGGGG + Intergenic
1050973936 9:11912399-11912421 CTTTTCACTCCCCTGGAAAGGGG - Intergenic
1051199409 9:14599605-14599627 TTGTTCACTCCCCTGGAAAGGGG + Intergenic
1051321968 9:15914635-15914657 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1051863408 9:21651839-21651861 CTGTTCACTCTCCTGGAAAGGGG - Intergenic
1051940247 9:22496438-22496460 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1052096616 9:24391469-24391491 CTGTTCGCTCCCCTGGAAAGGGG - Intergenic
1052125151 9:24765387-24765409 CTGTTCACTCCCCTGGACAGGGG - Intergenic
1052146924 9:25061298-25061320 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1052281241 9:26735562-26735584 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1052326469 9:27220932-27220954 CTATTCACTCCCCTGGAAAGGGG + Intronic
1052366226 9:27614922-27614944 CCGTTCACTCCCCTGGATAAGGG - Intergenic
1053608185 9:39681379-39681401 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1053866026 9:42437739-42437761 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1054245346 9:62661030-62661052 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1054559474 9:66695561-66695583 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1054719905 9:68594135-68594157 CTGTTCACTCCCCTGGAGATGGG - Intergenic
1055239204 9:74163647-74163669 CTGTTCAATCCCCTGGAAAGGGG + Intergenic
1055494555 9:76841469-76841491 CTGTTCACTCCCCTGGAAAGGGG + Intronic
1055571749 9:77623920-77623942 CCGTTCACTCCCCTGGAAAAGGG + Intronic
1056123713 9:83514114-83514136 CTATTCACTCCCCTGGAAAGGGG + Intronic
1056425500 9:86471652-86471674 TTATCAACTCACCTGGAACATGG - Intergenic
1056997802 9:91479634-91479656 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1058072902 9:100619599-100619621 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1058265772 9:102897574-102897596 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1058393159 9:104520322-104520344 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1060281091 9:122216214-122216236 CTGCTAACTTCTCTGTAACAGGG - Intronic
1060926301 9:127457593-127457615 ATGTAAACTCCCCAGGGACAGGG - Intronic
1061088161 9:128411417-128411439 CTGTTAACTCCTCTGGGCCCAGG - Intergenic
1185966156 X:4606441-4606463 CTCTTAACTACCCTGAAGCAAGG - Intergenic
1186181342 X:6976188-6976210 CTGTTCACTCCACTGGAAAGAGG - Intergenic
1186370041 X:8937380-8937402 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1186773334 X:12839346-12839368 CTGTTCACTCCCCTGAAAAGGGG - Intergenic
1186834451 X:13423424-13423446 CTGTCACATACCCTGGAACAAGG + Intergenic
1187205839 X:17180409-17180431 CTGTTTCCTCACCTGGAAAAAGG + Intergenic
1187815436 X:23226598-23226620 CTGTTTGCTCCACTTGAACAGGG + Intergenic
1188130041 X:26419753-26419775 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1188333956 X:28905403-28905425 CTGGTAAATCCCCTGGCAAAAGG - Intronic
1188664614 X:32804128-32804150 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1188893315 X:35636351-35636373 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1188921945 X:35987596-35987618 CGGTTTACTCCCCTGGAAAGGGG - Intronic
1189575132 X:42343359-42343381 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1189713571 X:43840950-43840972 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1190505851 X:51125378-51125400 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1190943996 X:55073055-55073077 CTGTTCACTCTCCTGGAAAGGGG - Intergenic
1191088737 X:56597654-56597676 CCATTCACTCCCCTGGAAAAAGG - Intergenic
1191113973 X:56832627-56832649 CTATTCACTCCCCTGGAAAGGGG - Intergenic
1191168557 X:57418217-57418239 CTGTTCACTCCCCTGGAAAAAGG - Intronic
1191172130 X:57458973-57458995 CCGTTCACTCCCCTGGAAAGAGG + Intronic
1191174187 X:57482226-57482248 CTGTTCACTCTCCTGGAAAGGGG - Intronic
1191194412 X:57705823-57705845 CTGTTCAGTCCCCTGGAAAGGGG + Intergenic
1191606226 X:63065795-63065817 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1191762631 X:64662092-64662114 CTGTTCACTCCTCTGGAAAGAGG - Intergenic
1191787720 X:64934979-64935001 ATGTTCACTCCCCTGGAAAGCGG + Intronic
1191795631 X:65018686-65018708 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1191824825 X:65353615-65353637 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1191941824 X:66489370-66489392 CTCTTCACTCCCCTGGAAAGGGG + Intergenic
1191962465 X:66718753-66718775 CTGTTCACTCCCCTAGTAAAGGG + Intergenic
1191975569 X:66867422-66867444 CAGTTACTTCTCCTGGAACATGG - Intergenic
1192030682 X:67509341-67509363 CTGTTCACTCCACTGGAAAGAGG + Intergenic
1192524527 X:71830117-71830139 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1192701807 X:73482313-73482335 CTGTCCACTCCCCTGGAAAGGGG - Intergenic
1192707392 X:73541040-73541062 CTGTTCACTCCCCTGAAAAGGGG + Intergenic
1192712637 X:73607470-73607492 ATGTTCACTCCCCTGGAAAGGGG - Intronic
1192931778 X:75814350-75814372 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
1192953199 X:76039603-76039625 CCATTCACTCCCCTGGAAAACGG - Intergenic
1192964140 X:76159463-76159485 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1193065408 X:77254198-77254220 CCGTTCACTCCCCTGGAAAAGGG + Intergenic
1193081607 X:77412028-77412050 CTGTTCACTCACCTGGAAAGGGG - Intergenic
1193228450 X:79013418-79013440 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1193284646 X:79697273-79697295 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1193350823 X:80462634-80462656 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1193389149 X:80906256-80906278 CTGTTTACTGCCCTGGAAAGGGG + Intergenic
1193404456 X:81084074-81084096 CTGTTCTCTCCCCTGGAAAGGGG + Intergenic
1193547991 X:82852775-82852797 CCATTCACTCCCCTGGAAAAGGG - Intergenic
1193562639 X:83037943-83037965 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1193646749 X:84079477-84079499 CTATTCACTCCCCTGGAAAGGGG + Intronic
1193829981 X:86278694-86278716 CTGTTCATTCCCCTGGAAAAGGG + Intronic
1193949310 X:87778563-87778585 CTGTTCACTACCCTGGAAAGGGG + Intergenic
1194158520 X:90422575-90422597 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
1194208525 X:91040161-91040183 CTGTTTACACCCCTGGAAAGGGG - Intergenic
1194515351 X:94845180-94845202 CAGTTCACTCCCCTGGAAAAGGG - Intergenic
1194576375 X:95618908-95618930 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1194624756 X:96214680-96214702 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1194643428 X:96429576-96429598 CCGTTCACTCCCCTGGAAGGGGG - Intergenic
1194736482 X:97518154-97518176 CTGCTCACTGCCATGGAACATGG + Intronic
1194954440 X:100162563-100162585 CCGTTTACTCCCCTGGAAAGGGG - Intergenic
1194963984 X:100266980-100267002 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1195102274 X:101567010-101567032 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1195140077 X:101950334-101950356 CCGTTTACTCCCCTGGAAAGGGG + Intergenic
1195233042 X:102870168-102870190 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1195519274 X:105812439-105812461 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1196133376 X:112181332-112181354 CTGTTCACTCCCCTGAAAAGGGG + Intergenic
1196269836 X:113697902-113697924 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1196281199 X:113825504-113825526 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1196308089 X:114127797-114127819 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1196467028 X:115983137-115983159 CTGTTCACTCCCCTGAAAAGGGG + Intergenic
1196571255 X:117268519-117268541 CTGTTCACTCCCCTGGAAAAGGG + Intergenic
1197365596 X:125561906-125561928 CTGTGCACTCCCCTGGAACAGGG + Intergenic
1197395618 X:125923322-125923344 CCGTTCACTCCCCTGGAAAGGGG - Intergenic
1197505980 X:127305957-127305979 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1197880776 X:131164399-131164421 CTGTTCACTCCCCTGCAAAGGGG - Intergenic
1197926911 X:131656385-131656407 CCGTTCACTCCCCTGGAAAGGGG + Intergenic
1198259227 X:134951230-134951252 CCATTCACTCCCCTGGAAAAGGG + Intergenic
1198645520 X:138802069-138802091 CTGTTTACTCCCCTGGAAAGGGG - Intronic
1198678727 X:139158262-139158284 CCGTTCACTCCCCTGGAAAGGGG + Intronic
1198680578 X:139177715-139177737 ATGTTCACTCCCCTGGAAAAGGG - Intronic
1198963526 X:142205503-142205525 CTGCTGACACCCCTGGAAAAAGG - Intergenic
1199401594 X:147405417-147405439 CTGTGCACTCCCCTGGAAAGGGG + Intergenic
1199452236 X:147989979-147990001 CTGTTCACTCCCCTGGAAAGGGG - Intronic
1199830660 X:151546208-151546230 CAGTTCACTCCCCTGGAAAGGGG + Intergenic
1200388516 X:155918295-155918317 CTGTTCACTCGCCTGGAAAGGGG - Intronic
1200504836 Y:3999543-3999565 CTGTTCACTCCTCTGGAAAGGGG + Intergenic
1200549332 Y:4558898-4558920 CGGTTCACTCCCCTGGAAAGGGG + Intergenic
1200573518 Y:4861919-4861941 TTGTTCACCCCCCTGGAAAAAGG - Intergenic
1200732608 Y:6758626-6758648 CTGTTCACTCCCCTGGAAAGGGG - Intergenic
1201543777 Y:15138265-15138287 CTCTAAACTCCCCTGGAAAAGGG - Intergenic
1201705075 Y:16928158-16928180 TGGTTCACTCCCCTGGAACCGGG + Intergenic
1201707117 Y:16949745-16949767 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1202335160 Y:23801157-23801179 CTGTTCACTCCCCTGGAAAGGGG + Intergenic
1202535607 Y:25868902-25868924 CTGTTCACTCCCCTGGAAAGGGG - Intergenic