ID: 1108242974

View in Genome Browser
Species Human (GRCh38)
Location 13:48486240-48486262
Sequence GCACACAACAGAATAATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108242974_1108242978 30 Left 1108242974 13:48486240-48486262 CCATAGATTATTCTGTTGTGTGC 0: 1
1: 0
2: 0
3: 18
4: 167
Right 1108242978 13:48486293-48486315 ACAAAGCTTAGGGAGCAAAACGG 0: 1
1: 0
2: 2
3: 21
4: 229
1108242974_1108242975 19 Left 1108242974 13:48486240-48486262 CCATAGATTATTCTGTTGTGTGC 0: 1
1: 0
2: 0
3: 18
4: 167
Right 1108242975 13:48486282-48486304 ACCTACACAAAACAAAGCTTAGG 0: 1
1: 0
2: 0
3: 13
4: 237
1108242974_1108242977 20 Left 1108242974 13:48486240-48486262 CCATAGATTATTCTGTTGTGTGC 0: 1
1: 0
2: 0
3: 18
4: 167
Right 1108242977 13:48486283-48486305 CCTACACAAAACAAAGCTTAGGG 0: 1
1: 1
2: 0
3: 12
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108242974 Original CRISPR GCACACAACAGAATAATCTA TGG (reversed) Intergenic
900749557 1:4386411-4386433 GAAAACAACAGACTAATGTAAGG + Intergenic
906275454 1:44512106-44512128 GCACAGAAAAGAAAAATCGATGG + Intronic
908414305 1:63898020-63898042 GCAGACAACAGAATGAGCTCCGG - Intronic
908763319 1:67532055-67532077 GGACCCACCAGAATAATCCAGGG - Intergenic
909060452 1:70873222-70873244 GCACATAGCAGAATAATTTGTGG - Intronic
909727769 1:78856230-78856252 CCACACAGCACAATAATATATGG - Intergenic
909839633 1:80302976-80302998 GAACATAACAGAATAAGATAGGG + Intergenic
914416613 1:147489523-147489545 GCATTCCACAGAATAATCTTTGG + Intergenic
914914745 1:151812617-151812639 GCACACATCAGAATCACCTGGGG - Intronic
918681121 1:187355083-187355105 ACACATAAAAGAAAAATCTAAGG + Intergenic
918837927 1:189492067-189492089 GCATACAATAGAATAATCAGAGG + Intergenic
920961503 1:210668060-210668082 GGACACAAAAGAATACTATATGG - Intronic
922122819 1:222690135-222690157 TCACACAACAAAATCACCTAAGG + Intronic
922439822 1:225645384-225645406 CCATACAACAGAATAATATTTGG - Intronic
922915055 1:229250414-229250436 GCTCACAAAAGAATATTCTCTGG - Exonic
1063567432 10:7183075-7183097 GCACACAATAGAAAACTCTCTGG + Intronic
1064588015 10:16859026-16859048 GAAAACACCAGAATAATCTCTGG + Intronic
1066793688 10:39094942-39094964 GAAAACAACAGAATATCCTAAGG + Intergenic
1071509151 10:86250511-86250533 GCACTCAGCAGGCTAATCTAAGG + Intronic
1074155769 10:110797928-110797950 GCACCCAAAATAAAAATCTATGG + Intronic
1076341271 10:129747206-129747228 GCAGACAACATAATTGTCTATGG - Intronic
1078177813 11:8983679-8983701 GCACACATCAGAATGAGCAATGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079218576 11:18538244-18538266 GAACACAAAAGAATAATACATGG - Intronic
1079616480 11:22499961-22499983 ACAAACAACAGAAGAATCTAGGG - Intergenic
1081091930 11:38881229-38881251 ACATATAAAAGAATAATCTAGGG - Intergenic
1083931182 11:65846582-65846604 GAATACGCCAGAATAATCTATGG + Intronic
1087854160 11:103070952-103070974 GCAAACACCTAAATAATCTATGG + Intronic
1087867662 11:103251860-103251882 GCACACAATGGAATAATGTTCGG - Intronic
1090101960 11:123807028-123807050 AGACACAAAAGCATAATCTAAGG - Intergenic
1090818336 11:130317774-130317796 GGAGACAAGGGAATAATCTAAGG - Intergenic
1094015198 12:25855535-25855557 GTATATAACTGAATAATCTAAGG - Intergenic
1099225146 12:79960518-79960540 AAACAAAACAGAATACTCTAGGG - Intergenic
1099597301 12:84683203-84683225 GTACACAAAAGAATGATTTATGG - Intergenic
1100346713 12:93738637-93738659 GCACAAAAAAGAATAACCAAAGG - Intronic
1100894973 12:99171382-99171404 GCAGACAACAGAAAAATGAAAGG + Intronic
1101377123 12:104180943-104180965 TCACACAACAGCATAAAGTAAGG + Intergenic
1103038691 12:117677077-117677099 GCATACAACAGCATCATCAAAGG + Intronic
1103155642 12:118682357-118682379 GCACAAAGCAGAATAATAAAAGG + Intergenic
1104484051 12:129134056-129134078 ACACACAACACAATACTCTATGG - Intronic
1104639257 12:130457039-130457061 GCACAGCCCAGAACAATCTACGG - Intronic
1108242974 13:48486240-48486262 GCACACAACAGAATAATCTATGG - Intergenic
1108917334 13:55631076-55631098 GCTATCAACAGAATGATCTAGGG - Intergenic
1109141740 13:58720825-58720847 GCACAAAAGAGAAAAATTTAAGG - Intergenic
1109632427 13:65068152-65068174 GCACAGAAAAGAATAATTTAAGG + Intergenic
1109987333 13:70006210-70006232 GCATACAACAGAATATTATTCGG - Intronic
1112116950 13:96366578-96366600 GTGCACATCAGAATCATCTAGGG + Intronic
1112477538 13:99745851-99745873 GTACAAATCAGAATAATCAAGGG + Intronic
1113963132 13:114136629-114136651 GTACACAACGGAATAATTTTTGG + Intergenic
1115759754 14:36568056-36568078 GCAGATAACAGAATATCCTAAGG + Intergenic
1116509635 14:45727715-45727737 GCACACAACTGAAAAATAAATGG - Intergenic
1118255866 14:64205370-64205392 TCACACAAAAGAATTATGTATGG + Intronic
1121499854 14:94426084-94426106 GAACTCTACAGAATATTCTAGGG - Intergenic
1124238457 15:28009846-28009868 ACACACATCTAAATAATCTATGG + Intronic
1124268832 15:28262304-28262326 GAACACCACAGAAGAATCTCAGG + Intronic
1124583285 15:30981601-30981623 GCAAATAACAGAAGAATCTGTGG - Intronic
1124693095 15:31842173-31842195 GCACAAAACAGGCAAATCTATGG + Intronic
1125326020 15:38536536-38536558 TTACACAACAAAATAATATAAGG + Intronic
1125392114 15:39204947-39204969 GCAGACACCAGAAGAAGCTAGGG + Intergenic
1128750337 15:70144152-70144174 GCACACAAGAGTCTAATATAGGG - Intergenic
1141892514 16:86935879-86935901 CCACACAACAGAATATTATTCGG - Intergenic
1141967661 16:87457774-87457796 GCACCCAACAGAATATTAAAAGG + Intronic
1145217461 17:21062673-21062695 GCACACAACAGAAGAAGCTTGGG + Intergenic
1146314217 17:31794607-31794629 GCACATACCAGAATTATCTGGGG + Intergenic
1147415586 17:40287156-40287178 GCACAGAACATAATATTCTTAGG + Intergenic
1155090736 18:22507212-22507234 GCACTCAACAGAAGACTCAAGGG - Intergenic
1155854731 18:30818817-30818839 GCAAACAAAAGAATACTCTATGG + Intergenic
1159492718 18:69159232-69159254 GCACACAGCAGAATAAAGGAGGG + Intergenic
1162185349 19:8900538-8900560 GCACATAACAGAATTTTCAATGG + Intronic
1163644253 19:18479325-18479347 GCAGAAAGCAGAAAAATCTATGG + Intronic
1165217535 19:34286936-34286958 GCATACATCAGAATCATCTGGGG + Intronic
1168428183 19:56256522-56256544 GCACACACCTGAAAAATGTAAGG - Intronic
928006742 2:27569171-27569193 ACACACAACAAAAGAATCTCTGG + Intergenic
929043433 2:37768813-37768835 CCACACAACACAATAAACTCGGG - Intergenic
929098646 2:38287528-38287550 CCGCACAACAGAATCATCTGGGG + Intergenic
929817610 2:45247488-45247510 AAACAAAACAAAATAATCTAGGG - Intergenic
930884307 2:56307075-56307097 GCCCAAATCAGAAAAATCTAGGG + Intronic
932884359 2:75535012-75535034 GCACACAAAAACATAAACTAGGG - Intronic
933108296 2:78361401-78361423 GCATACAAGAGAAAAATCTAAGG - Intergenic
938061050 2:128254576-128254598 GAACACCACAGAAAAATCTGTGG + Intronic
938190988 2:129280534-129280556 GCATACAACAAAATTATGTATGG + Intergenic
939001997 2:136747376-136747398 CCAAACATCAGAATAATCCAAGG + Intergenic
939247634 2:139645775-139645797 GCCCACAGCAGCACAATCTATGG + Intergenic
940853493 2:158710325-158710347 GCACACTTCAAAATAATCCATGG - Intergenic
941004642 2:160235487-160235509 ACATACAATAGAAAAATCTATGG - Intronic
942207544 2:173635444-173635466 GCACACTTCTAAATAATCTATGG + Intergenic
945003019 2:205372005-205372027 GCACACAATAGAATATTATTAGG - Intronic
945067688 2:205960929-205960951 GCACACAGCAGAATCACCGAGGG + Intergenic
946151681 2:217777939-217777961 ACACACCACAGAAAAATCTATGG + Intergenic
948075237 2:235160730-235160752 GAACCCACCAGGATAATCTACGG + Intergenic
948998923 2:241600927-241600949 GCAGACAACAGATTAACCCATGG + Intronic
1169641924 20:7761845-7761867 CCACACACCAGAATCATCTCAGG + Intergenic
1171077792 20:22146856-22146878 GCCCACAAAAGAATTATCTATGG - Intergenic
1174620522 20:51870894-51870916 GCACACATCAGAAGAACATAGGG + Intergenic
1174719613 20:52797943-52797965 CCAAACATCACAATAATCTAGGG - Intergenic
1177084664 21:16688288-16688310 GCAAACAACAGAATAAAATATGG + Intergenic
1181908902 22:26222189-26222211 GCATGCACCAGAATCATCTAAGG - Intronic
952555886 3:34530293-34530315 GCACACTACAGAAAAATGTTTGG + Intergenic
953777330 3:45831878-45831900 GCACACAGGAGAATATTCTCTGG + Intronic
954968514 3:54632360-54632382 GAAAAAAACAGAATACTCTAGGG - Intronic
955879434 3:63527935-63527957 GCATGGAACAGAATATTCTAGGG + Intronic
957995295 3:87680444-87680466 GGACACAACAGTATCATATAAGG + Intergenic
958708861 3:97692853-97692875 GCACACAGGATAATGATCTATGG - Intronic
959856018 3:111160111-111160133 GAACAAAACAGAATACTCCATGG + Intronic
960480089 3:118177338-118177360 GCACACATCTAAATAATCTATGG + Intergenic
961768486 3:129230502-129230524 GCACACAACAGAATTGCCTAAGG - Intergenic
962569443 3:136697518-136697540 CCACACATTAGAATCATCTAGGG - Intronic
963842439 3:150121348-150121370 TCACACAGCAGAATATTATATGG + Intergenic
964440734 3:156706519-156706541 GCAAACAACAGGATTAACTAGGG - Exonic
965097271 3:164247648-164247670 GTACAAAACAGAATAAGCAAAGG - Intergenic
966363178 3:179151478-179151500 CTACACATTAGAATAATCTAGGG + Intronic
966960520 3:184933092-184933114 GCATACATCAGAATAATGTAGGG - Intronic
968190256 3:196662041-196662063 GGACACTACAAAATAATCCAAGG - Intronic
972689616 4:41383775-41383797 TCACACACCAGAATCACCTATGG - Intronic
972801836 4:42483922-42483944 GCACATAACAGATGACTCTAGGG + Intronic
973386127 4:49515406-49515428 CCACACTACAGAATCACCTACGG + Intergenic
976627430 4:87201758-87201780 GCACACATCTAAATAATCCATGG + Intronic
978263875 4:106798503-106798525 GCACAGAAGAGCATAATCTGAGG - Intergenic
978334760 4:107654548-107654570 ACACTCATCACAATAATCTAAGG + Intronic
979387148 4:120080120-120080142 GCACAGAACTTAAAAATCTATGG + Intergenic
979653885 4:123168732-123168754 GTATACAACAAAATAATCTTTGG - Intronic
979985673 4:127311380-127311402 GAAAACTACAGAATAATCTCAGG + Intergenic
981160840 4:141496662-141496684 GCACAAAACAGATGAATCTTGGG + Intergenic
983339723 4:166444269-166444291 ACACACCAAAGAACAATCTAGGG - Intergenic
984276982 4:177622794-177622816 ACACACAAAAAAATGATCTATGG - Intergenic
987533492 5:19151890-19151912 GCAGAAAACAGAATAATTTTAGG - Intergenic
987979813 5:25068529-25068551 GCATACAAGAGAATACTATAAGG + Intergenic
988265832 5:28950197-28950219 GCACAAAACACAACAATCTAAGG + Intergenic
990320567 5:54626038-54626060 TCATGCAACAGAAAAATCTAGGG - Intergenic
993137395 5:83986886-83986908 GCACACAAGAGAATAACCATGGG + Intronic
993787552 5:92162210-92162232 ACATACAAGAGAATAAACTATGG - Intergenic
994165810 5:96606962-96606984 GCACACATCAGATTCATCTGGGG - Intronic
995755561 5:115500006-115500028 GCACACAACAGAATACTATTTGG - Intergenic
998694322 5:144621835-144621857 CTTCACAACAGAATAATCTCTGG + Intergenic
998933424 5:147206681-147206703 GCACACAACAGATTAAGACAAGG + Intergenic
1000679657 5:164167517-164167539 GCTCACTACATAGTAATCTATGG + Intergenic
1001145917 5:169184578-169184600 ACACACAACAAAATCACCTAGGG + Intronic
1002547269 5:179957683-179957705 GTACACAAAAGAATAAAGTAGGG - Intronic
1003688820 6:8331657-8331679 ACACACAAAATAATAATCTGGGG + Intergenic
1006212428 6:32408107-32408129 GCTCACAACAGATGAACCTAAGG - Intergenic
1006693614 6:35911913-35911935 GCATACTACAGAAAAATCTTTGG + Intronic
1007191751 6:40024803-40024825 GCTCAAAACAGAATGCTCTATGG - Intergenic
1008715380 6:54283155-54283177 GTAGACAACAGCATAATGTATGG - Intergenic
1009777529 6:68223971-68223993 GCACAAAAGAGTATGATCTAAGG + Intergenic
1010979266 6:82351959-82351981 GCAAACAACAAAAAAATGTAGGG - Intergenic
1011652258 6:89517402-89517424 GCACATAATAGAATAAACTTTGG + Intronic
1012842359 6:104344887-104344909 AAACACCACAGAAAAATCTATGG - Intergenic
1015257733 6:131198834-131198856 GGACTCAGCAGAATATTCTAGGG + Intronic
1016537103 6:145119792-145119814 GCATATAATAGAATATTCTATGG - Intergenic
1018859319 6:167699235-167699257 GCACACATCAGAAACATCTGGGG + Intergenic
1020323651 7:6958237-6958259 GCACACAACAGAACAAAGAATGG + Intergenic
1020557129 7:9684355-9684377 GCATACAACAGAATAACAAAAGG - Intergenic
1021823784 7:24526053-24526075 GCAGACAACATGATTATCTATGG + Intergenic
1022892147 7:34712491-34712513 TCACACAACAGAAAAATAGATGG - Intronic
1023678923 7:42663401-42663423 TCATACAACAGGATCATCTAAGG + Intergenic
1031030135 7:116725490-116725512 ACACACAAAAGAATTATGTACGG + Intronic
1034199113 7:149270675-149270697 GGTCACATCAGAATAACCTATGG - Intronic
1036130264 8:6103276-6103298 GCACTCAACAGAATTCTGTAAGG - Intergenic
1036545472 8:9765322-9765344 GTACACATCAGAATAACCCAGGG + Intronic
1038886958 8:31674125-31674147 GCATACAACAGAATATTATTTGG - Intronic
1039599400 8:38821795-38821817 TCACACAACAAAATCACCTAAGG - Intronic
1041675027 8:60529816-60529838 GCAGGCACAAGAATAATCTATGG - Intronic
1042528452 8:69790699-69790721 GCACACATCAGAATAATATGCGG + Intronic
1043220678 8:77659098-77659120 GCACTTAACAGAATAATAAAGGG + Intergenic
1044889231 8:96814803-96814825 CCATACAACAGAATAGTCTTTGG + Intronic
1045767344 8:105690051-105690073 GCACACTATAGAATATCCTAAGG + Intronic
1045790255 8:105975788-105975810 GCTCATAACAGAATACTCAAAGG + Intergenic
1046107763 8:109687024-109687046 GCAAAAAACGGAAAAATCTAAGG + Intronic
1046225262 8:111270463-111270485 GCAAACAAATGAAAAATCTAAGG + Intergenic
1048257954 8:132919806-132919828 GTACACAACATAATAATCAAAGG + Intronic
1051882855 9:21857808-21857830 GCAACCAAAAGAATAATTTAAGG - Intronic
1051957420 9:22713074-22713096 GCACACTGCAGAGTAACCTATGG - Intergenic
1057194273 9:93108130-93108152 GCACACAACAGTATAAGATACGG + Intronic
1057723252 9:97549603-97549625 ACACACAACAGAATCATTTGGGG - Intronic
1186376090 X:9003211-9003233 GCACACAACAGCCTAGTCAATGG - Intergenic
1186537727 X:10367208-10367230 GCTCTGAACACAATAATCTAGGG + Intergenic
1186694611 X:12016965-12016987 GCACACAACAGCCTAGTCAATGG - Intergenic
1188281542 X:28276183-28276205 GCACACTTCAAAACAATCTATGG - Intergenic
1188874362 X:35411908-35411930 GAAATCAACAGAGTAATCTATGG + Intergenic
1190882512 X:54502341-54502363 TTACACAACAGAATACTATAAGG + Intergenic
1191892730 X:65961337-65961359 TCACACATTAGAATCATCTAGGG - Intergenic
1195462646 X:105144992-105145014 GGACACAGCAGAATAAAATATGG - Intronic
1199651383 X:149948217-149948239 GAACACAACACAAGAATCTAAGG - Intergenic
1202244905 Y:22810331-22810353 TCACACAACAGAGTAGTCGAAGG + Intergenic
1202397894 Y:24444077-24444099 TCACACAACAGAGTAGTCGAAGG + Intergenic
1202472887 Y:25226010-25226032 TCACACAACAGAGTAGTCGAAGG - Intergenic