ID: 1108244722

View in Genome Browser
Species Human (GRCh38)
Location 13:48502973-48502995
Sequence CAGTTAAACCTGGCGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1405
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 1344}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108244722_1108244732 18 Left 1108244722 13:48502973-48502995 CCTCCTCCCGCCAGGTTTAACTG 0: 1
1: 0
2: 4
3: 56
4: 1344
Right 1108244732 13:48503014-48503036 TTACAAAAAGGGTCAGGAAAAGG 0: 1
1: 0
2: 1
3: 24
4: 347
1108244722_1108244729 6 Left 1108244722 13:48502973-48502995 CCTCCTCCCGCCAGGTTTAACTG 0: 1
1: 0
2: 4
3: 56
4: 1344
Right 1108244729 13:48503002-48503024 GACATCATAAAATTACAAAAAGG 0: 1
1: 0
2: 4
3: 56
4: 585
1108244722_1108244731 12 Left 1108244722 13:48502973-48502995 CCTCCTCCCGCCAGGTTTAACTG 0: 1
1: 0
2: 4
3: 56
4: 1344
Right 1108244731 13:48503008-48503030 ATAAAATTACAAAAAGGGTCAGG 0: 1
1: 0
2: 1
3: 55
4: 1201
1108244722_1108244730 7 Left 1108244722 13:48502973-48502995 CCTCCTCCCGCCAGGTTTAACTG 0: 1
1: 0
2: 4
3: 56
4: 1344
Right 1108244730 13:48503003-48503025 ACATCATAAAATTACAAAAAGGG 0: 1
1: 0
2: 5
3: 74
4: 902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108244722 Original CRISPR CAGTTAAACCTGGCGGGAGG AGG (reversed) Intronic
901010070 1:6195665-6195687 CACTTAAACCTGGAAGGTGGAGG + Intronic
901076744 1:6559904-6559926 CACTTGAACCTGGTGGGTGGAGG + Intronic
901247490 1:7744213-7744235 CACTTAAACCTGGGAGGTGGAGG - Intronic
901502239 1:9659997-9660019 CACTTAAACCTGGGAGGCGGAGG - Intronic
901553269 1:10012125-10012147 CACTTGAACCTGGGAGGAGGAGG + Intronic
901553371 1:10012848-10012870 CACTTGAACCTGGGAGGAGGAGG + Intronic
901733667 1:11298481-11298503 CACTTAAACCTGGGAGGTGGAGG + Intergenic
902320934 1:15665176-15665198 CACTTAAACCTGGGAGGCGGAGG + Exonic
902517925 1:16999815-16999837 CACTTGAACCTGGGGGGTGGAGG + Intronic
902536299 1:17120862-17120884 CAATTAAACCTGGGAGGCGGAGG - Intergenic
902569465 1:17337829-17337851 CACTTCAACCTGGGGGGTGGAGG + Intronic
903097487 1:20991482-20991504 CACTTGAACCTGGGAGGAGGAGG + Intronic
903428380 1:23272020-23272042 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
903484194 1:23677464-23677486 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
903506567 1:23839885-23839907 CACTTGAACCTGGGAGGAGGAGG - Intergenic
903550164 1:24152524-24152546 CACTTGAACCTGGGGGGTGGAGG + Intergenic
903619392 1:24686919-24686941 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
903968180 1:27102550-27102572 CGGTTGAGCCTGGTGGGAGGAGG + Exonic
904074172 1:27827379-27827401 CACTTGAACCTGGCGGGTGGAGG + Intergenic
904107382 1:28097389-28097411 CACTTAAACCTGGGAGGTGGAGG - Intergenic
904137156 1:28322014-28322036 CACTTGAACCTGGTGGGTGGAGG + Intergenic
904183630 1:28685291-28685313 CACTTAAACCTGGGAGGCGGAGG - Intronic
904217161 1:28930566-28930588 CACTTAAACCTGGGAGGCGGAGG - Intronic
904403743 1:30273204-30273226 CAGTGAACACTGGTGGGAGGGGG + Intergenic
904682439 1:32238893-32238915 CACTTGAACCTGGGAGGAGGAGG + Intergenic
905616517 1:39404385-39404407 CACTTAAACCTGGGAGGTGGAGG + Intronic
906102146 1:43270667-43270689 CAGGTGAGCCTGCCGGGAGGAGG - Exonic
906266226 1:44432352-44432374 CACTTGAACCTGGGGGGTGGAGG - Intronic
906277612 1:44528696-44528718 CACTTAAACCTGGGAGGTGGAGG - Intronic
906311131 1:44755347-44755369 CACTTAAACCTGGGAGGTGGAGG - Intronic
906312827 1:44766140-44766162 CACTTAAACCTGGGAGGCGGAGG + Intronic
906354452 1:45092378-45092400 CACTTGAACCTGGAGGGTGGAGG - Intronic
906411051 1:45579930-45579952 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
906432491 1:45766318-45766340 CACTTCAACCTGGGGGGTGGAGG + Intergenic
906435092 1:45788504-45788526 CACTTGAACCTGGGAGGAGGAGG + Intronic
906506331 1:46382683-46382705 CACTTAAACCTGGGAGGTGGAGG - Intergenic
906981857 1:50639848-50639870 CGCTTAAACCTGGGAGGAGGAGG + Intronic
907105925 1:51882502-51882524 CACTTAAACCTGGGTGGTGGAGG + Intergenic
907117755 1:51984178-51984200 CACTTGAACCTGGCAGGCGGAGG + Intronic
907132963 1:52113170-52113192 CACTTAAACCTGGGAGGCGGAGG - Intergenic
907194115 1:52672664-52672686 CACTTGAACCTGGCAGGCGGAGG - Intergenic
907452310 1:54553382-54553404 CAGTTGAACCTGGGAGGTGGAGG + Intronic
907516977 1:54998992-54999014 CAGTTCAACAGGGCTGGAGGCGG - Exonic
907841916 1:58166827-58166849 CACTTGAACCTGGGGGGCGGAGG - Intronic
907932912 1:59016767-59016789 CACTTGAACCTGGCAGGAGGAGG + Intergenic
909062418 1:70894223-70894245 CACTTGAACCTGGTGGGCGGAGG + Intronic
909307818 1:74103788-74103810 CAGGTAAATATGGCGGGGGGGGG - Intronic
909606912 1:77516985-77517007 CACTTGAACCTGGGGGGTGGAGG + Intronic
909965353 1:81902512-81902534 CACTTGAACCTGGTGGGTGGAGG + Intronic
910259046 1:85278341-85278363 CACTTGAACCTGGGAGGAGGAGG - Intergenic
910310591 1:85819929-85819951 CACTTCAACCTGGCAGGTGGAGG - Intronic
910691362 1:89968806-89968828 CACTTAAACCTGGGAGGTGGAGG - Intergenic
910894854 1:92058355-92058377 CAGTTGAACCTGGGAGGTGGAGG + Intronic
911168369 1:94745212-94745234 CACTTGAACCTGGAAGGAGGAGG + Intergenic
911182315 1:94872183-94872205 CACTTAAACCTGGGAGGCGGAGG - Intronic
911233622 1:95385912-95385934 CACTTGAACCTGGAGGGCGGAGG + Intergenic
911269905 1:95788565-95788587 AAGTGAAAGCTGGGGGGAGGGGG - Intergenic
911638939 1:100266622-100266644 GAGGTAAATCTGGCTGGAGGGGG + Exonic
912020627 1:105105173-105105195 CACTTAAACCTGGGAGGCGGAGG - Intergenic
912144160 1:106771701-106771723 CACTTGAACCTGGGAGGAGGAGG + Intergenic
913345139 1:117801359-117801381 CACTTGAACCTGGGAGGAGGAGG + Intergenic
913562281 1:120033325-120033347 CACTTGAACCTGGGGGGCGGAGG + Intronic
913635843 1:120760269-120760291 CACTTGAACCTGGGGGGCGGAGG - Intergenic
913997535 1:143663850-143663872 CACTTGAACCTGGGAGGAGGAGG - Intergenic
914282866 1:146192713-146192735 CACTTGAACCTGGGGGGCGGAGG + Intronic
914543896 1:148643429-148643451 CACTTGAACCTGGGGGGCGGAGG + Intronic
914622725 1:149427580-149427602 CACTTGAACCTGGGGGGCGGAGG - Intergenic
914683984 1:149961641-149961663 CAGTTAATGCTGGCCGGATGCGG - Intronic
914772820 1:150705439-150705461 CACTTGAACCTGGGAGGAGGAGG + Intronic
914808857 1:151011860-151011882 CACTTGAACCTGGCAGGCGGAGG - Intronic
914930190 1:151924290-151924312 CACTTGAACCTGGCAGGTGGAGG - Intergenic
915315858 1:155028787-155028809 CACTTAAACCTGGGAGGCGGAGG + Intronic
915388996 1:155523785-155523807 CACTTGAACCTGGCAGGCGGAGG + Intronic
915392434 1:155556526-155556548 CAGTTGAACCTGGGAGGTGGAGG - Intronic
916183978 1:162113181-162113203 CTGATAATCCTGGCAGGAGGTGG + Intronic
916617105 1:166453378-166453400 CACTTGAACCTGGCAGGTGGAGG - Intergenic
916674110 1:167052040-167052062 AAGTCAAACCTGGGGGAAGGTGG + Intergenic
916677323 1:167074983-167075005 CACTTGAACCTGGCGGGAGGAGG - Intronic
916794752 1:168155459-168155481 CACTTGAACCTGGGAGGAGGAGG - Intergenic
917165978 1:172113534-172113556 CACTTGAACCTGGGGGGCGGAGG + Intronic
917326376 1:173836457-173836479 CACTTCAACCTGGGAGGAGGAGG + Intronic
917337529 1:173940903-173940925 CACTTGAACCTGGGAGGAGGAGG - Intronic
917829261 1:178861954-178861976 CACTTGAACCTGGGGGGCGGAGG - Intronic
918208258 1:182328590-182328612 CAGTATAACCTGGCTGAAGGTGG - Intergenic
918301122 1:183204904-183204926 CACTTGAACCTGGGAGGAGGAGG - Intronic
919590445 1:199495177-199495199 CACTTGAACCTGGGAGGAGGAGG + Intergenic
919652045 1:200159733-200159755 CACTTAAACCTGGGAGGTGGAGG - Intronic
919687704 1:200499511-200499533 CACTTGAACCTGGGAGGAGGAGG + Intergenic
919692935 1:200543652-200543674 CACTTGAACCTGGGAGGAGGAGG + Intergenic
919815237 1:201433307-201433329 CACTTGAACCTGGAGGGTGGAGG - Intergenic
919890147 1:201966276-201966298 CAGTTGAACCTGGGAGGTGGAGG + Intronic
920138160 1:203787329-203787351 CACTTGAACCTGGGAGGAGGAGG + Intergenic
920864424 1:209739854-209739876 CACTTGAACCTGGGGGGTGGAGG + Intergenic
920961601 1:210668855-210668877 CACTTGAACCTGGGAGGAGGAGG - Intronic
920971878 1:210749824-210749846 CACTTGAACCTGGGAGGAGGAGG - Intronic
921061450 1:211588492-211588514 CACTTAAACCTGGAAGGTGGAGG + Intergenic
921086637 1:211800116-211800138 CACTTAAACCTGGGAGGTGGAGG - Intronic
921689661 1:218133496-218133518 CACTTAAACCTGGGAGGTGGAGG + Intergenic
921796788 1:219354278-219354300 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
921952275 1:220942858-220942880 CACTTAAACCTGGGAGGCGGAGG - Intergenic
922115716 1:222611812-222611834 CACTTGAACCTGGGAGGAGGAGG - Intergenic
922333593 1:224600271-224600293 CACTTAAACCTGGGAGGTGGAGG - Intronic
922424231 1:225478740-225478762 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
922541520 1:226423870-226423892 CAGTTGAGCCTGACAGGAGGAGG - Intergenic
922649412 1:227324401-227324423 CAATTAAACCTGGGAGGTGGAGG - Intergenic
923101056 1:230817908-230817930 CACTTGAACCTGGGAGGAGGAGG - Intergenic
923414830 1:233746407-233746429 CACTTGAACCTGGGAGGAGGAGG + Intergenic
923485441 1:234425139-234425161 CACTTAAACCTGGGAGGCGGAGG + Intronic
923497502 1:234538299-234538321 CAGTTAACACTGCCGGGAGGTGG - Intergenic
923889922 1:238202432-238202454 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
923967448 1:239157334-239157356 CACTTAAACCTGGGAGGCGGAGG - Intergenic
923977597 1:239281700-239281722 CACTTGAACCTGGGAGGAGGAGG - Intergenic
924103173 1:240624795-240624817 CACTTGAACCTGGGAGGAGGAGG + Intergenic
924158406 1:241205542-241205564 CACTTGAACCTGGGGGGTGGAGG - Intronic
924239602 1:242028612-242028634 CACTTGAACCTGGGGGGAGGAGG - Intergenic
924260060 1:242220818-242220840 CACTTAAACCTGGGAGGTGGAGG - Intronic
924323507 1:242872496-242872518 CACTTAAACCTGGCAGGCAGAGG + Intergenic
924323717 1:242874595-242874617 CACTTGAACCTGGCAGGCGGAGG + Intergenic
924468754 1:244321067-244321089 CACTTAAACCTGGAAGGCGGAGG + Intergenic
924515343 1:244761092-244761114 CACTTGAACCTGGGGGGTGGAGG - Intergenic
924714053 1:246555872-246555894 CACTTGAACCTGGGAGGAGGAGG - Intronic
1063588195 10:7372008-7372030 CACTTGAACCTGGGGGGTGGAGG - Intronic
1063669464 10:8088199-8088221 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1063712500 10:8493344-8493366 CACTTAAACCTGGGGGGCGGAGG - Intergenic
1063806652 10:9652220-9652242 CACTTGAACCTGGGGGGGGGAGG + Intergenic
1063869349 10:10401435-10401457 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1063869537 10:10402926-10402948 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1064541726 10:16412565-16412587 CGCTTGAACCTGGGGGGAGGAGG + Intergenic
1064864563 10:19865028-19865050 CAGTTCAATGTGGCTGGAGGAGG + Intronic
1064873652 10:19968394-19968416 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1065801340 10:29355922-29355944 CACTTGAACTTGGCGGGTGGAGG - Intergenic
1065808604 10:29419697-29419719 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1066201347 10:33145084-33145106 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1066285835 10:33965106-33965128 CACTTAAACTTGGGAGGAGGAGG + Intergenic
1066345491 10:34581316-34581338 CATTTGAACCTGGAGGGTGGAGG - Intronic
1066378303 10:34879374-34879396 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1066382977 10:34917446-34917468 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1066421972 10:35272068-35272090 CACTTGAACCTGGCAGGCGGAGG - Intronic
1066594726 10:37037855-37037877 CACTTGAACCTGGCAGGTGGGGG - Intergenic
1067060108 10:43073922-43073944 CAGGTTTGCCTGGCGGGAGGCGG - Intergenic
1067106864 10:43372366-43372388 CACTTAAACCTGGAAGGTGGAGG - Intronic
1067392703 10:45879149-45879171 CACTTGAACCTGGAGGGTGGAGG + Intergenic
1067457018 10:46426245-46426267 CATTTAAACCTGGGAGGTGGAGG - Intergenic
1067630186 10:47958393-47958415 CATTTAAACCTGGGAGGTGGAGG + Intergenic
1067733326 10:48829766-48829788 CACTTGAACCTGGGAGGAGGAGG + Intronic
1067739413 10:48883136-48883158 CAGTTAAAGCTGGTGCAAGGAGG + Intronic
1067861029 10:49848263-49848285 CACTTGAACCTGGAGGGTGGAGG + Intronic
1067993141 10:51238496-51238518 CTCTTAAACCTGGGAGGAGGAGG + Intronic
1068279707 10:54853174-54853196 CACTTAAACCTGGTTGGCGGAGG + Intronic
1068526810 10:58139721-58139743 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1068871898 10:61954271-61954293 CACTTGAACCTGGGGGGTGGGGG + Intronic
1069007626 10:63336035-63336057 CACTTAAACCTCGCAGGCGGAGG + Intronic
1069282182 10:66668726-66668748 CACTTAAACCTGGGCGGTGGAGG + Intronic
1069466081 10:68640345-68640367 CACTTGAACCTGGCGGGCAGAGG - Intronic
1069537897 10:69268888-69268910 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1069717245 10:70529215-70529237 CAGTTGTACCTGGGGGGGGGGGG - Exonic
1070006520 10:72429334-72429356 CAGTTGAACCTGGGAGGTGGAGG + Intronic
1070834510 10:79439706-79439728 CTCTTGAACCTGGGGGGAGGTGG + Intronic
1071028301 10:81141449-81141471 CATTTAAGCCTGGGAGGAGGAGG - Intergenic
1071058621 10:81542518-81542540 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1071272424 10:84020203-84020225 CACTTAAACTTGGTGGGGGGAGG + Intergenic
1071699142 10:87910508-87910530 CACTTGAACCTGGCGGGAGGAGG - Intronic
1072132827 10:92513274-92513296 CACTTGAACCTGGGGGGTGGAGG - Intronic
1072140278 10:92583453-92583475 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1072211647 10:93251863-93251885 CACTTGAACCTGGGAGGAGGTGG + Intergenic
1072455507 10:95571871-95571893 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1072508652 10:96095891-96095913 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1072585309 10:96776516-96776538 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1072921558 10:99581281-99581303 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1073232730 10:101985932-101985954 CATTTGAACCTGGGGGGCGGAGG + Intronic
1073295686 10:102437065-102437087 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1073590407 10:104752116-104752138 CACTTAAACCTGGGAGGCGGAGG - Intronic
1074010440 10:109473506-109473528 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1074557228 10:114502578-114502600 CACTTGAACCTGGGAGGAGGAGG - Intronic
1074638731 10:115352814-115352836 CACTTAAACCTGGGAGGTGGAGG + Intronic
1075042304 10:119117881-119117903 CAGTTGAACCTGGAAGGCGGAGG + Intronic
1075500576 10:122970036-122970058 CACTTGAACCTGGGGGGTGGAGG + Intronic
1075606459 10:123814939-123814961 CACTTGAACCTGGAGGGTGGAGG + Intronic
1076017659 10:127041179-127041201 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1076224102 10:128759405-128759427 CACTGAAGCCTGGCAGGAGGTGG - Intergenic
1076285875 10:129295899-129295921 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1076925878 10:133486550-133486572 CAGTTGAACCTGGGAGGAAGAGG - Intergenic
1077010157 11:376060-376082 CAGGTACACCTGGGGGGTGGGGG - Exonic
1077063937 11:630439-630461 CACTTAAACCTGGTAGGCGGAGG - Intergenic
1077205359 11:1339780-1339802 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1077271095 11:1681634-1681656 CATTTAAACCTGGGGGTTGGAGG + Intergenic
1078154992 11:8791681-8791703 CATTTGAACCTGGGAGGAGGAGG + Intronic
1078438395 11:11344363-11344385 CAGGTAAACCTAGCGGAAGGGGG - Intronic
1078497273 11:11830869-11830891 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1078904226 11:15669406-15669428 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1079058955 11:17230803-17230825 CACTTAAACCTGGGAGGAGGAGG + Intronic
1079107819 11:17584607-17584629 CAGTTAGACCTGGGAGGTGGAGG - Intronic
1079226047 11:18605772-18605794 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1079254021 11:18810922-18810944 CAGCTGAACGTGGCTGGAGGAGG + Intergenic
1079281969 11:19095762-19095784 CAGTTGAACCTGGGGGGTGGAGG + Intergenic
1079547244 11:21647464-21647486 CAGTGAATCCTGAGGGGAGGTGG - Intergenic
1079593178 11:22206398-22206420 CACTTAAACCTGGGAGGTGGAGG - Intronic
1079764298 11:24371478-24371500 CACTTGAGCCTGGAGGGAGGAGG - Intergenic
1080513052 11:32994316-32994338 CAGCAAAACCTGGCTTGAGGTGG - Intergenic
1080631088 11:34076815-34076837 CACTTAAACCTGGGAGGCGGAGG - Intronic
1081550269 11:44105373-44105395 CACTTAAACCTGGGAGGCGGAGG - Intronic
1081916691 11:46736117-46736139 CACTTGAACCTGGGAGGAGGAGG + Intronic
1082216181 11:49572856-49572878 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1083591618 11:63898716-63898738 CAGTCAGAGCTGGCTGGAGGTGG - Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083799629 11:65039105-65039127 CACTTGAACCTGGGGGGCGGAGG - Intronic
1083982005 11:66179933-66179955 CACTTGAACCTGGCAGGCGGAGG - Intronic
1084127159 11:67107108-67107130 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1084380410 11:68808453-68808475 CATTTAAACCTGGGAGGCGGAGG - Intronic
1084759394 11:71259464-71259486 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
1084921438 11:72473851-72473873 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1085322029 11:75580986-75581008 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1085598645 11:77834496-77834518 CACTTGAACCTGGGAGGAGGAGG - Intronic
1086158597 11:83695653-83695675 CACTTAAACCTGGGAGGTGGAGG + Intronic
1086783452 11:90935776-90935798 CATTTGAACCTGGGGGGTGGAGG - Intergenic
1087140528 11:94761270-94761292 CACTTAAACCTGGGAGGCGGAGG - Intronic
1087320394 11:96651078-96651100 CGCTTAAACCTGGGAGGAGGAGG + Intergenic
1087656113 11:100924909-100924931 CACTTAAACCTGGCAGGTGGAGG - Intronic
1087863446 11:103193625-103193647 CAGTTAAACCCGGGAGGCGGAGG - Intronic
1087957129 11:104302356-104302378 CACTTAAACCTGGGAGGGGGAGG + Intergenic
1088057497 11:105602909-105602931 CAGTTGAACCTGGGAGGAAGAGG - Intergenic
1088239874 11:107762219-107762241 CACTTAAACCCGGGGGGTGGGGG + Intergenic
1088541299 11:110916344-110916366 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1088695375 11:112361866-112361888 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1088862235 11:113811602-113811624 CACTTCAACCTGGCAGGCGGAGG + Intronic
1089111509 11:116061586-116061608 CAGTGAAGCCAGGCTGGAGGGGG + Intergenic
1089342621 11:117768990-117769012 CACTTGAACCTGGGGGGTGGAGG + Intronic
1089484311 11:118833063-118833085 CATTTAAACCTGGGAGGTGGAGG - Intergenic
1089506592 11:118966887-118966909 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1090382064 11:126334425-126334447 CACTTGAACCTGGCAGGAGAAGG - Intronic
1090477175 11:127033904-127033926 CAGATAGACCTGGCAGGGGGTGG + Intergenic
1090487157 11:127123513-127123535 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1090777858 11:129980953-129980975 CAATTGAACCTGGGAGGAGGAGG - Intronic
1090778106 11:129983058-129983080 CACTTGAACCTGGGGGGCGGAGG - Intronic
1090815762 11:130293710-130293732 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1091266893 11:134277686-134277708 CAATTAAACCTGGAGGGGGCGGG - Exonic
1091276055 11:134351427-134351449 CACTTGAACCTGGGAGGAGGAGG - Intronic
1091468259 12:704439-704461 CGCTTGAACCTGGCGGGTGGAGG + Intergenic
1091482465 12:847888-847910 CACTTAAACCTGGGAGGCGGAGG - Intronic
1091487264 12:901597-901619 CATTCAAACCTGGTGGCAGGAGG + Intronic
1091735851 12:2921221-2921243 CACTTGAACCTGGGAGGAGGAGG - Intronic
1091795363 12:3294791-3294813 CCGTTCAACCTGGTGGGAGGGGG + Intergenic
1092076362 12:5676968-5676990 CACTTGAACCTGGCAGGTGGAGG + Intronic
1092338473 12:7655123-7655145 CACTTGAACCTGGGGAGAGGAGG + Intronic
1092498663 12:9024109-9024131 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1092551128 12:9501371-9501393 CGCTTGAACCTGGCGGGCGGAGG - Intergenic
1092572773 12:9743428-9743450 CACTTCAACCTGGCAGGGGGAGG - Intergenic
1092585456 12:9896941-9896963 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1092650543 12:10630300-10630322 CACTTAAACCTGGGAGGCGGAGG + Intronic
1093239126 12:16647425-16647447 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
1093432304 12:19097988-19098010 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1093447847 12:19280792-19280814 CACTTAAACCTGGGAGGTGGAGG - Intronic
1093481282 12:19606462-19606484 CACTTGAACCTGGCAGGTGGAGG - Intronic
1093737640 12:22639591-22639613 CACTTGAACCTGGGGGGCGGAGG + Intronic
1093952750 12:25182261-25182283 CACTTGAACCTGGGGGGCGGAGG + Intronic
1094046626 12:26174602-26174624 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1094076437 12:26480754-26480776 CACTTGAACCTGGGAGGAGGAGG + Intronic
1094520676 12:31184985-31185007 CGCTTGAACCTGGCGGGCGGAGG + Intergenic
1094534093 12:31305781-31305803 CGCTTAAACCTGGCAGGCGGAGG - Intronic
1094551527 12:31456244-31456266 CACTTGAACCTGGCAGGTGGAGG + Intronic
1094690053 12:32759861-32759883 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1095101394 12:38188566-38188588 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1095370766 12:41464906-41464928 CACTTGAACCTGGGAGGAGGGGG - Intronic
1095477700 12:42602775-42602797 CAGTTAATACCGGGGGGAGGGGG + Intergenic
1095764909 12:45884310-45884332 CACTTAAACCTGGGAGGTGGAGG + Intronic
1095896602 12:47286113-47286135 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1096081438 12:48835624-48835646 CACTTGAACCTGGGAGGAGGAGG + Intronic
1096092457 12:48912175-48912197 CACTTGAACCTGTGGGGAGGAGG + Intronic
1096160743 12:49374875-49374897 CACTTGAACCTGGCAGGCGGAGG + Intronic
1096173462 12:49493483-49493505 CACTTAAACCTGGGAGGTGGAGG - Intronic
1096235064 12:49920876-49920898 CAGTCAAGCCTGGCGTGTGGGGG + Intergenic
1096390648 12:51226414-51226436 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1096434922 12:51581352-51581374 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1096449117 12:51722280-51722302 CAGTCAAAGCAGGTGGGAGGAGG - Intronic
1096569410 12:52512564-52512586 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1096976475 12:55702097-55702119 CACTTGAACCTGGGTGGAGGAGG - Intronic
1097133187 12:56828934-56828956 CACCTGAACCTGGCGGGTGGAGG + Intergenic
1097235997 12:57539966-57539988 CAGTTGAACCCGGCAGGCGGAGG + Intronic
1097761609 12:63472164-63472186 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1097816701 12:64082532-64082554 CACTTAAACCTGGGAGGTGGAGG - Intronic
1097845613 12:64362606-64362628 CAGTTCAACCTGGGGGGCAGAGG + Intronic
1098046041 12:66401493-66401515 CAGTTGAACCTGGAAGGCGGAGG + Intronic
1098263231 12:68692831-68692853 CATTTAAACCTGGGAGGCGGAGG - Intronic
1098310511 12:69144309-69144331 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1098542353 12:71670853-71670875 CACTTAAACCTGGGAGGTGGAGG + Intronic
1098889886 12:75999150-75999172 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1099646397 12:85362736-85362758 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1100284481 12:93152232-93152254 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1100305180 12:93343959-93343981 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1100614611 12:96221379-96221401 CAGTTAAAAGTGGGGGGTGGCGG + Intronic
1101238162 12:102810992-102811014 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1101420209 12:104544621-104544643 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1101619619 12:106372419-106372441 CACTTGAACCTGGGGGGCGGAGG - Intronic
1101911778 12:108865479-108865501 CACTTGAGCCTGGGGGGAGGAGG - Intronic
1101974680 12:109346676-109346698 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1102071818 12:110026491-110026513 CACTTGAACCTGGCAGGCGGAGG + Intronic
1102340510 12:112117743-112117765 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1102361384 12:112290762-112290784 CACTTGAACCTGGGAGGAGGAGG + Intronic
1102838944 12:116097227-116097249 CACTTGAACCTGGGGGGTGGCGG - Intronic
1103374960 12:120448410-120448432 CACTTGAACCTGGAGGGTGGAGG - Intronic
1103504306 12:121431213-121431235 CACTTAAACCTGGGAGGCGGAGG - Intronic
1103544211 12:121688267-121688289 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
1103658218 12:122491742-122491764 CACTTGAACCTGGCAGGTGGAGG + Intronic
1104012801 12:124943791-124943813 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1104023656 12:125010690-125010712 CACTTGAACCTGGGAGGAGGAGG + Intronic
1104056693 12:125236227-125236249 CACTTGAACCTGGGAGGAGGGGG - Intronic
1104114232 12:125733966-125733988 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1104555845 12:129799179-129799201 CACTTGAACCTGGAGGGTGGAGG + Intronic
1104626539 12:130360547-130360569 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1104693985 12:130849503-130849525 CACTTGAACCTGGAGGGCGGAGG - Intergenic
1105213233 13:18270062-18270084 CACTTAAACCTGGGAGGGGGAGG + Intergenic
1105324418 13:19356845-19356867 CACTTGAACCTGGCGGGGGATGG - Intergenic
1105333559 13:19441001-19441023 CACTTGAACCTGGGGGGTGGAGG + Intronic
1105371762 13:19807953-19807975 CACTTAAACTTGGGAGGAGGAGG + Intergenic
1105480023 13:20766213-20766235 CACTTGAACCTGGGAGGAGGAGG + Intronic
1105826389 13:24127121-24127143 CAGTCAATCCTGGCAGGAAGGGG + Intronic
1106043213 13:26113846-26113868 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1106161616 13:27205812-27205834 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1106395376 13:29374840-29374862 CACTTGAACCTGGGAGGAGGAGG + Intronic
1106548860 13:30754153-30754175 CACTTAAACCTGGGAGGCGGAGG + Intronic
1106586729 13:31063659-31063681 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1106941671 13:34787037-34787059 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1107441699 13:40433390-40433412 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1108031201 13:46231591-46231613 CACTTGAACCTGGCAGGCGGAGG - Intronic
1108123696 13:47217625-47217647 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1108243056 13:48487145-48487167 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1108244457 13:48500472-48500494 CACTTGAACCTGGGAGGAGGAGG + Intronic
1108244722 13:48502973-48502995 CAGTTAAACCTGGCGGGAGGAGG - Intronic
1108329325 13:49369669-49369691 CACTTGAACCTGGCAGGTGGAGG - Intronic
1108341420 13:49501772-49501794 CACTTGAACCTGGGAGGAGGAGG - Intronic
1108389567 13:49935510-49935532 CAGTTAGACCTGTTGGGAAGAGG + Intronic
1109447803 13:62466914-62466936 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1109971782 13:69779892-69779914 CACTTGAACCTGGCAGGTGGAGG - Intronic
1110196313 13:72792210-72792232 CACTTGAACCTGGCAGGAGGAGG + Intronic
1110275761 13:73640312-73640334 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1110595738 13:77318668-77318690 CACTTGAACCTGGCAGGCGGAGG + Intronic
1110928607 13:81187247-81187269 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1111451480 13:88423941-88423963 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1112043257 13:95569498-95569520 CACTTGAACCTGGGGGGTGGAGG + Intronic
1112265977 13:97923784-97923806 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1112904484 13:104400413-104400435 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1113320899 13:109231026-109231048 CACTTGGACCTGGCAGGAGGAGG - Intergenic
1113734138 13:112665071-112665093 CAGCCCAACCTGGAGGGAGGTGG - Intronic
1114497258 14:23141531-23141553 CACTTAAACCTGGGAGGCGGAGG - Intronic
1115063684 14:29227064-29227086 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1115308733 14:31958256-31958278 CACTTGAACCTTGCGGGGGGAGG - Intergenic
1115308847 14:31959062-31959084 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1115352389 14:32409114-32409136 CACTTGAACCTGGCAGGTGGAGG + Intronic
1115568374 14:34644805-34644827 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1115672597 14:35630785-35630807 CACTTGAACCTGGCAGGCGGAGG + Intronic
1116305399 14:43247310-43247332 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1116448944 14:45043259-45043281 CACTTAAACCTGGGAGGTGGAGG - Intronic
1116878148 14:50134987-50135009 CAATTGAACCTGGCAGGCGGAGG + Intronic
1116880230 14:50160468-50160490 CACTTAAACCTGGGAGGGGGAGG - Intronic
1116974236 14:51097735-51097757 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1117368703 14:55055844-55055866 CACTTAAACCTGGGAGGCGGAGG + Intronic
1117512111 14:56462927-56462949 CACTTGAACCTGGGAGGAGGCGG + Intergenic
1118028801 14:61799589-61799611 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1118299371 14:64601696-64601718 CGGCGAAACCTGGCGCGAGGCGG + Intergenic
1118386474 14:65259666-65259688 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1118525188 14:66632574-66632596 CACTTGAACCTGGGAGGAGGAGG - Intronic
1118600540 14:67468809-67468831 CACTTAAACCTGGGAGGCGGAGG + Intronic
1118631788 14:67712001-67712023 CACTTGAACCTGGGAGGAGGAGG - Intronic
1118794401 14:69128268-69128290 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1118827175 14:69394512-69394534 CACTTGAACCTGGGGGGCGGAGG + Intronic
1118836766 14:69483834-69483856 CATTTCCACCTGCCGGGAGGAGG + Intergenic
1118841013 14:69511631-69511653 CCCTTGAACCTGGCAGGAGGAGG - Intronic
1118867389 14:69714195-69714217 ACTTTAAAGCTGGCGGGAGGAGG - Exonic
1119213097 14:72847593-72847615 CACTTAAACCTGGGAGGCGGAGG - Intronic
1119570579 14:75667842-75667864 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1119632411 14:76244438-76244460 CACTTGAACCTGGGAGGAGGAGG + Intronic
1119831059 14:77703060-77703082 CACTTGAACCTGGCAGGCGGAGG + Intronic
1119961956 14:78868735-78868757 CACTTGAACCTGGGAGGAGGAGG + Intronic
1120094806 14:80376325-80376347 CACTTAAACCTGGGAGAAGGAGG + Intronic
1120415473 14:84213774-84213796 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1120679129 14:87458383-87458405 CAGATAAACCTGGAGTGAGGTGG + Intergenic
1120687672 14:87556791-87556813 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1121044858 14:90780295-90780317 CACTTAAACCTGGGAGGCGGAGG + Intronic
1121340569 14:93102570-93102592 CACTTAAACCTGGGAGGTGGAGG + Intronic
1121475390 14:94196394-94196416 CACTTGAACCTGGCGGGTGGAGG - Intronic
1121497605 14:94405444-94405466 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1121784015 14:96641033-96641055 CACTTGAACCTGGCAGGTGGAGG - Intergenic
1121966442 14:98311292-98311314 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1122475212 14:102003343-102003365 CACTTGAACCTGGGAGGAGGAGG - Intronic
1122487872 14:102093888-102093910 CACTTGAACCTGAGGGGAGGAGG + Intronic
1122705167 14:103616316-103616338 CACTTGAACCTGGGGGGTGGAGG + Intronic
1202942949 14_KI270725v1_random:172659-172681 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1123461476 15:20476180-20476202 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1123632268 15:22269730-22269752 CTGTTAAACCTAGGGGCAGGAGG + Intergenic
1124146853 15:27135819-27135841 CACTCAAACCTGGAAGGAGGAGG + Intronic
1124354900 15:28987838-28987860 CACTTGAACCTGGCAGGCGGAGG - Intronic
1124603870 15:31156111-31156133 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1125097984 15:35876427-35876449 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1125586195 15:40821842-40821864 CAGTCAAACCTGGGAGGCGGAGG + Intronic
1125595485 15:40882929-40882951 CACTTTAACCTGGGAGGAGGAGG - Intergenic
1125598373 15:40901820-40901842 CACTTGAACCTGGGAGGAGGAGG + Intronic
1125688956 15:41581104-41581126 CACTTAAACCTGGGAGGAGGAGG + Exonic
1125811044 15:42541418-42541440 CAGTTGAACCTGGTAGGTGGAGG + Exonic
1125896181 15:43304144-43304166 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
1125958923 15:43812104-43812126 CACTTGAACCTGGCAGGCGGAGG + Intronic
1126133796 15:45370855-45370877 CATTTGAACCTGGTGGGAGGCGG - Intronic
1126620892 15:50638463-50638485 CACTTGAACCTGGGAGGAGGAGG + Intronic
1126652609 15:50939387-50939409 CACTTGAACCTGGGGGGTGGAGG + Intronic
1126765562 15:52007928-52007950 CACTTAAACCTGGGAGGTGGAGG - Intronic
1127972877 15:63975680-63975702 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1128291261 15:66480170-66480192 CACTTGAACCTGGGAGGAGGAGG - Intronic
1128305919 15:66598933-66598955 CACTCAAACCTGGGAGGAGGAGG - Intronic
1128500515 15:68223960-68223982 CACTTAAACCTGGGAGGCGGAGG + Intronic
1128949438 15:71860881-71860903 CACTTAAACCTGGAAGGCGGAGG + Intronic
1128957669 15:71965653-71965675 CGCTTAAACCTGGAGGGCGGAGG + Intronic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1129348771 15:74941573-74941595 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1129415719 15:75377539-75377561 CACTTGAACCTGGCTGGTGGAGG + Intronic
1129498022 15:76005602-76005624 CACTTGAACCTGGGGGGTGGAGG + Intronic
1129609843 15:77044480-77044502 AAGTTAAAACTGGCAGGAGCTGG + Exonic
1129945508 15:79536238-79536260 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1129968862 15:79759762-79759784 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1130341745 15:83005366-83005388 CACTTGAACCTGGGGGGCGGAGG - Intronic
1130578636 15:85115651-85115673 CAGTTAATCCTGGCCGGGAGCGG + Intronic
1130630282 15:85561139-85561161 CACTTGAACCTGGGGGGCGGAGG - Intronic
1130814947 15:87421342-87421364 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1130962062 15:88666876-88666898 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1130976097 15:88776421-88776443 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1131140733 15:89975023-89975045 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1131185849 15:90273653-90273675 CAGTTGAACCTGGGAGGCGGAGG - Exonic
1131474345 15:92723808-92723830 CACTTGAACCTGGGGGGCGGAGG + Intronic
1132067328 15:98742951-98742973 CACTTGAACCTGGGAGGAGGAGG + Intronic
1132606673 16:796548-796570 CAGTTAAACCTGGCTGCCGCAGG + Intronic
1132658709 16:1052188-1052210 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1132853667 16:2035547-2035569 CAGTTAAACATGGCGGTGGCCGG - Intronic
1133146405 16:3790456-3790478 CACTTAAACCTGGGAGGTGGAGG - Intronic
1133210144 16:4259002-4259024 CACTTGAACCTGGGAGGAGGAGG + Intronic
1133258717 16:4534800-4534822 CAGTTGAACCTGGCAGGTGGAGG - Intronic
1133334494 16:4998087-4998109 CGCTTGAACCTGGCGGGGGGCGG - Intronic
1133528822 16:6633359-6633381 CACTTGAACCTGGGAGGAGGAGG - Intronic
1133563725 16:6973045-6973067 CAGTTGAACCTGGGAGGTGGAGG + Intronic
1133661357 16:7920876-7920898 CAGTTGAACCTGGGAAGAGGAGG + Intergenic
1133786882 16:8980924-8980946 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1133950535 16:10387984-10388006 CACTTGAACCCGGAGGGAGGAGG - Intronic
1133950958 16:10392135-10392157 CACTTGAACCTGGGGGGTGGGGG - Intronic
1134046288 16:11103494-11103516 CACTTGAACCTGGCAGGTGGAGG + Intronic
1134076118 16:11292661-11292683 CAGGCAAACCTGGTGGGAGTGGG + Intronic
1134141814 16:11726494-11726516 CACTTGAACCTGGCAGGTGGAGG + Intronic
1134179050 16:12032936-12032958 CACTTGAACCTGGGGGGTGGAGG - Intronic
1134228252 16:12408734-12408756 CACTTAAACCTGGGAGGCGGAGG + Intronic
1134280338 16:12811252-12811274 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1134280453 16:12812433-12812455 CACTTGAACCTGGAGGGCGGAGG - Intergenic
1134407609 16:13975427-13975449 CACTTGAACCTGCCGGGTGGAGG + Intergenic
1134488083 16:14674615-14674637 CACTTAAACCTGGGGGGCAGAGG + Intronic
1134621439 16:15692491-15692513 CACTTGAACCTGGGAGGAGGGGG - Intronic
1134658919 16:15969118-15969140 CACTTGAACCTGGGAGGAGGAGG + Intronic
1134814796 16:17196925-17196947 CACTTGAACCTGGTGGGTGGAGG + Intronic
1134909424 16:18010944-18010966 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1135108213 16:19669752-19669774 CACTTGAACCTGGGGGGTGGAGG - Intronic
1135115996 16:19723874-19723896 CACTTGAACCTGGGAGGAGGAGG + Intronic
1135230122 16:20698590-20698612 CAATTAAACCTGGGAGGCGGAGG - Intronic
1135272352 16:21080211-21080233 CACTTGAACCTGGGAGGAGGAGG + Intronic
1135302948 16:21346332-21346354 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1135568609 16:23530973-23530995 CACTTAAACCTGGGAGGTGGAGG - Intronic
1135740512 16:24971411-24971433 CACTTGAACCTGGCAGGCGGCGG - Intronic
1135816244 16:25636585-25636607 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1135977234 16:27116761-27116783 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1136047827 16:27629082-27629104 CACTTAAACCTGGGAGGCGGAGG + Intronic
1136299692 16:29325526-29325548 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1136339259 16:29631258-29631280 CAGTTGAACCTGGAAGGCGGAGG + Intergenic
1136472684 16:30492332-30492354 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1136489929 16:30600808-30600830 CACTTGAACCTGGGAGGAGGTGG + Intergenic
1136525879 16:30830000-30830022 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1136581513 16:31154175-31154197 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1136712183 16:32248121-32248143 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1136755731 16:32681283-32681305 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1136812382 16:33189089-33189111 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1136818858 16:33299169-33299191 CACTTGAACCTGGCAGGCGGAGG + Intronic
1136825421 16:33355702-33355724 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1136830487 16:33454473-33454495 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1137254245 16:46761732-46761754 CACTTGAACCTGGGGGGTGGGGG + Intronic
1137947575 16:52749711-52749733 CATTTAAACCTGGGAGGCGGAGG - Intergenic
1138017398 16:53441902-53441924 CACTTAAACCTGGGAGGCGGAGG - Intronic
1138434924 16:56992558-56992580 CACTTAAACCTGGGAGGTGGAGG - Intronic
1138588457 16:57986160-57986182 CAGTCAAACCTGGTGGGATGTGG - Intronic
1138614079 16:58150673-58150695 CACTTGAACCTGGTGGGTGGAGG - Intergenic
1138743664 16:59338481-59338503 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1139091556 16:63654342-63654364 CACTTAAACCTGGCAGGCAGAGG + Intergenic
1139351613 16:66339952-66339974 CACTTAAACCGGGGAGGAGGAGG - Intergenic
1139718399 16:68832871-68832893 CAGTTAAATCTGGGGAGTGGGGG - Intronic
1139746137 16:69076173-69076195 CACTTAAACCTGGGAGGTGGAGG - Intronic
1139796003 16:69483383-69483405 CATTTAAACCTGGGAGGTGGAGG + Intergenic
1139854646 16:69970689-69970711 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1139883631 16:70193603-70193625 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1139888472 16:70228854-70228876 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
1140056975 16:71533956-71533978 CACTTGAACCTGGGAGGAGGAGG + Intronic
1140116738 16:72048517-72048539 CACTTGAACCTGGGGGGCGGAGG - Intronic
1140368880 16:74401913-74401935 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1140451987 16:75078380-75078402 CACTTGAACCTGGGGGGCGGAGG - Intronic
1140937193 16:79684323-79684345 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1141027535 16:80562329-80562351 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1141710191 16:85694313-85694335 CACTTGAACCTGGGAGGAGGAGG + Intronic
1141847016 16:86617723-86617745 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1142042979 16:87907132-87907154 CGCTTGAACCTGGCGGGTGGAGG + Intronic
1142340700 16:89520478-89520500 CGCTTAAACATGGCGGGCGGAGG - Intronic
1202990959 16_KI270728v1_random:12059-12081 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1203057874 16_KI270728v1_random:941639-941661 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1142718506 17:1761479-1761501 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1142747599 17:1967721-1967743 CGCTTAAACCTGGGAGGAGGAGG - Intronic
1142845382 17:2671290-2671312 CACTTAAACCTGGGAGGCGGAGG - Intronic
1143136198 17:4713878-4713900 CACTTAAACCTGGGAGGCGGAGG + Intronic
1143197048 17:5083948-5083970 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1143261639 17:5603650-5603672 CACTTGAACCTGGGAGGAGGAGG - Intronic
1143380132 17:6490876-6490898 CACTTAAACCTGGGAGGCGGGGG + Intronic
1143560573 17:7691918-7691940 CACTTAAACCTGGGAGGCGGAGG - Intronic
1143791582 17:9300245-9300267 CACTTGAACCTGGGAGGAGGAGG + Intronic
1143848991 17:9795309-9795331 CACTTGAACCTGGGAGGAGGAGG - Intronic
1144878419 17:18416413-18416435 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1145000047 17:19298276-19298298 CACTTGAACCTGGGGGGCGGAGG - Intronic
1145048469 17:19638884-19638906 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1145059163 17:19721371-19721393 CAGGGAGACCTTGCGGGAGGAGG - Intergenic
1145153814 17:20527980-20528002 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
1145835229 17:27949814-27949836 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
1145837680 17:27967025-27967047 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1145882129 17:28360049-28360071 CACTTAAACCTGGAAGGCGGAGG - Intronic
1146709578 17:35029425-35029447 CACTTAAACCTGGGAGGCGGCGG - Intronic
1147016627 17:37497224-37497246 CACTTGAACCTGGAGGGCGGAGG - Intronic
1147288923 17:39425716-39425738 CACTTGAACCTGGGGGGCGGAGG + Intronic
1147468491 17:40633091-40633113 CACTTGAACCTGGCAGGTGGAGG - Intronic
1147601121 17:41746223-41746245 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1147615338 17:41824057-41824079 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1147641923 17:42007927-42007949 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1147874363 17:43610647-43610669 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1148060590 17:44833334-44833356 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
1148155408 17:45422080-45422102 CAGTTGAATCTGGCAGGCGGAGG + Intronic
1148234831 17:45961857-45961879 CAATTGAACCTGGCAGGTGGAGG - Intronic
1148260995 17:46183454-46183476 CACTTGAGCCTGGCGGGTGGAGG + Intronic
1148504550 17:48117136-48117158 CACTTAAACCTGGGAGGCGGAGG - Intronic
1149023002 17:51991723-51991745 CACTTGAACCTGGGAGGAGGAGG + Intronic
1149599653 17:57885287-57885309 CAGATGAACCTGGAGGGCGGTGG - Exonic
1149806686 17:59624550-59624572 CACTTGAACCTGGCAGGTGGAGG - Intronic
1149962175 17:61123023-61123045 CACTTAAACCAGGGAGGAGGAGG - Intronic
1150139258 17:62714827-62714849 CACTTAAACCTGGGAGGCGGAGG - Intronic
1150164834 17:62931847-62931869 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1150228431 17:63536558-63536580 CAGTTGAACCTGGGAGGTGGAGG + Intronic
1150262236 17:63803482-63803504 CACTTAAACCTTGGAGGAGGAGG + Intronic
1150275082 17:63891917-63891939 CACTTGAACCTGGGAGGAGGCGG + Intergenic
1150341503 17:64371744-64371766 CACTTGAACCTGGTGGGCGGAGG + Intronic
1150763133 17:67980259-67980281 CATTTGAACCTGGGAGGAGGAGG + Intronic
1150821119 17:68435121-68435143 CACTTAAACCTGGGAGGCGGAGG + Intronic
1151164989 17:72195974-72195996 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1151225914 17:72648244-72648266 CACTTGAACCTGGGGGGCGGAGG + Intronic
1151268602 17:72976084-72976106 CACTTGAACCTGGGAGGAGGAGG + Intronic
1151536179 17:74740070-74740092 CATTTAAACCTGGGAGGTGGAGG + Intronic
1151628710 17:75295052-75295074 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1151644170 17:75418461-75418483 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1151938032 17:77275340-77275362 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1151951806 17:77358553-77358575 CACTTAAACCTGGGAGGTGGAGG + Intronic
1152112240 17:78363452-78363474 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1152193139 17:78900676-78900698 CAGATAACCCTTGGGGGAGGTGG + Intronic
1152394153 17:80022418-80022440 CACTTGAACCTGGCAGGAAGAGG - Intronic
1152444837 17:80335891-80335913 CACTTAAACCTGGAAGGTGGAGG + Intronic
1203161296 17_GL000205v2_random:53375-53397 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1153083608 18:1257130-1257152 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1153298618 18:3572531-3572553 CACTTGAACCTGGGGGGTGGAGG - Intronic
1153882924 18:9436158-9436180 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1153898108 18:9587797-9587819 CACTTGAACCTGGGAGGAGGTGG - Intronic
1154063367 18:11084091-11084113 CACTTGAACCTGGGGGGTGGAGG + Intronic
1154302638 18:13207759-13207781 CAGTTGACCCTGGAGGGTGGTGG - Intergenic
1154477708 18:14780359-14780381 CACTTGAACCTGGGAGGAGGAGG + Intronic
1154987663 18:21568817-21568839 CACTTAAACCTGGGAGGCGGAGG + Intronic
1155022619 18:21910360-21910382 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1155058617 18:22207730-22207752 CACTTGAACCTGGCAGGTGGAGG - Intergenic
1155285885 18:24288682-24288704 CACTTAAACCTGGAAGGCGGAGG + Intronic
1155297892 18:24401983-24402005 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1155535882 18:26816979-26817001 CACTTGAACCTGGCAGGTGGAGG - Intergenic
1156329141 18:36102762-36102784 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1157345931 18:46832806-46832828 CACTTGAACCTGGGGGGTGGGGG + Intronic
1157548028 18:48561152-48561174 CACTTGAACCTGGCGTGTGGAGG + Intronic
1157652664 18:49350620-49350642 CATTTAAACCTGGGAGGCGGAGG + Intronic
1157668391 18:49507400-49507422 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1157734493 18:50034658-50034680 CACTTGAACCTGGGGGGCGGAGG + Intronic
1158327242 18:56325226-56325248 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1158690399 18:59655001-59655023 CACTTAAACCTGGGAGGCGGAGG + Intronic
1158951696 18:62500896-62500918 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1158951819 18:62502168-62502190 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1159120217 18:64160470-64160492 CAGTTCCACATGGCTGGAGGAGG + Intergenic
1159165356 18:64691940-64691962 CGCTTGAACCTGGCGGGTGGAGG - Intergenic
1159440029 18:68466398-68466420 CACTTAAACCTGGGAGGAGGAGG - Intergenic
1159444159 18:68519658-68519680 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1159531559 18:69662061-69662083 CACTTGAACCTGGCAGGGGGAGG - Intronic
1159612239 18:70539042-70539064 CACTTCAACCTGGGGGGCGGAGG - Intergenic
1159730148 18:72015928-72015950 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1160586001 18:79913990-79914012 CACTTGAACCTGGGGGGCGGAGG - Intronic
1160741341 19:687487-687509 CGGTTGAACCTGGCAGGTGGAGG - Intronic
1160743974 19:701843-701865 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1160758546 19:771254-771276 CACTTGAACCTGGGAGGAGGCGG + Intergenic
1161143346 19:2662174-2662196 CACTTGAACCTGGGGGGCGGAGG + Intronic
1161351357 19:3793783-3793805 CACTTAAACCTGGGAGGTGGAGG + Intronic
1161403468 19:4079136-4079158 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
1161496762 19:4590834-4590856 CAGGTCAACCTGGGGGGAGAGGG - Intergenic
1161701542 19:5798576-5798598 CGCTTAAACCTGGGAGGAGGAGG - Intergenic
1161869410 19:6858814-6858836 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1161991170 19:7685184-7685206 CACTTAAACCTGGGAGGCGGAGG + Exonic
1162454909 19:10777676-10777698 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1162508459 19:11102396-11102418 CACTTTAACCTGGGAGGAGGAGG - Intronic
1162694136 19:12458818-12458840 CACTTGAACCTGGGAGGAGGGGG + Intronic
1162823792 19:13238667-13238689 CACTTAAACCTGGGAGGTGGAGG - Intronic
1162828088 19:13266655-13266677 CACTTAAACCTGGGAGGTGGAGG - Intronic
1162832842 19:13297912-13297934 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1162835362 19:13313414-13313436 CACTTAAACCTGGGAGGTGGAGG + Intronic
1162878317 19:13637602-13637624 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1162883479 19:13678204-13678226 CAGTTGAACCTGGGAGGAGGAGG - Intergenic
1162984444 19:14260600-14260622 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1163067919 19:14812979-14813001 CACTTAAACCTGGGAGGCGGAGG + Intronic
1163119107 19:15205737-15205759 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
1163279699 19:16308044-16308066 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1163480041 19:17549898-17549920 CACTTGAACCTGGGAGGAGGAGG - Intronic
1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG + Intergenic
1163894930 19:20050591-20050613 CAGTTCTACATGGCTGGAGGTGG + Intergenic
1163914207 19:20225321-20225343 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1163918839 19:20268640-20268662 CATTTGAACCTGGAGGGTGGAGG + Intergenic
1164049991 19:21577561-21577583 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1164076865 19:21827443-21827465 CACTTAAACCTGGGAGGCGGAGG - Intronic
1164140511 19:22457583-22457605 CAGTTGAGCCTGGGAGGAGGAGG - Intronic
1164262754 19:23582388-23582410 CACTTGAACCTGGGAGGAGGAGG + Intronic
1164280240 19:23762590-23762612 CATTTGAACCTGGGAGGAGGAGG + Intergenic
1164295089 19:23902919-23902941 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1164454145 19:28392960-28392982 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1164563181 19:29308144-29308166 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
1164649262 19:29880253-29880275 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1164880953 19:31732405-31732427 CTCTTAAACCTGGCAGGTGGAGG + Intergenic
1164979919 19:32606234-32606256 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1164982578 19:32625512-32625534 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1165174646 19:33919058-33919080 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1165244126 19:34488157-34488179 CACTTGAACCTGGGGGGCGGAGG - Intronic
1165406635 19:35634740-35634762 CACTTGAACCTGGGGGGCGGAGG - Intronic
1165605424 19:37099705-37099727 CACTTGAACCTGGCAGGCGGAGG - Intronic
1165622478 19:37259966-37259988 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1165837062 19:38764811-38764833 CACTTGAACCTGGGAGGAGGGGG + Intronic
1166223533 19:41380828-41380850 CACTTAAACCTGGGAGGCGGAGG + Intronic
1166224917 19:41389027-41389049 CACTTAAACCTGGAGGGTGGAGG - Intronic
1166515252 19:43441660-43441682 CAGTTGAACCCGGGGGGTGGAGG + Intergenic
1166651462 19:44578427-44578449 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1166694203 19:44843376-44843398 CACTCAAACCTGGGGGGCGGAGG + Intergenic
1166708749 19:44923894-44923916 CGCTTAAACCCGGCGGGTGGAGG + Intergenic
1166723437 19:45010937-45010959 CACTTAAACCTGGGAGGTGGAGG - Intronic
1166964594 19:46521165-46521187 AAGTGAAACCTGGCTGGACGCGG + Intronic
1167023877 19:46900303-46900325 CACTTAAACCTGGGAGGAGGAGG - Intergenic
1167053530 19:47094799-47094821 CAGTCTAACCTGGCTGGGGGAGG + Intronic
1167078185 19:47261626-47261648 CACTTAAACCTGGGAGGTGGAGG + Intronic
1167093852 19:47363032-47363054 CACTTAAACCTGGGAGGCGGAGG - Intronic
1167177181 19:47873251-47873273 CACTTGAACCTGGGAGGAGGAGG - Intronic
1167254873 19:48421342-48421364 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1167388027 19:49176005-49176027 CGCTTAAACCTGGGAGGAGGAGG - Intronic
1167539991 19:50079686-50079708 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1167629712 19:50618082-50618104 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1167815462 19:51876842-51876864 CACTTAAACCTGGGAGGTGGAGG + Intronic
1167821665 19:51933880-51933902 CATTTGAACCTGGCAGGTGGAGG - Intronic
1167870187 19:52362325-52362347 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1168028969 19:53664712-53664734 CATTTGAACCTGGGGGGCGGAGG + Intergenic
1168071230 19:53953142-53953164 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1168086217 19:54048998-54049020 CACTTAAACCTGGGAGGCGGAGG + Intronic
1168088884 19:54068644-54068666 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1168222843 19:54973457-54973479 CACTTAAACCTGGGAGGAGGAGG - Intronic
1168362407 19:55753117-55753139 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1168603232 19:57737346-57737368 CACTTGAACCTGGGCGGAGGAGG - Intronic
1168672041 19:58247995-58248017 CACTTGAACCTGGGGGGCGGAGG - Intronic
925066730 2:933591-933613 CACTTGAACCTGGCAGGCGGAGG + Intergenic
925187324 2:1857944-1857966 CACTTGAACCTGGGAGGAGGAGG - Intronic
925337887 2:3111887-3111909 CACTTAAACCTGGGAGGTGGAGG + Intergenic
925377182 2:3395644-3395666 CACTTAAACCTGGGAGGCGGAGG - Intronic
925711688 2:6747296-6747318 CACTTGAACCTGGCAGGGGGAGG + Intergenic
925764461 2:7217554-7217576 CAGTTGAACCTGGAAGGCGGAGG + Intergenic
925964045 2:9046691-9046713 CACTTCAACCTGGGGGGTGGAGG - Intergenic
926898754 2:17726002-17726024 CACTTAAACCTGAGGGGTGGAGG + Intronic
927573148 2:24177354-24177376 CACTTGAACCTGGAGGGCGGAGG + Intronic
928000089 2:27516372-27516394 CACTTGAACCTGGGGGGCGGAGG - Intronic
928131959 2:28658283-28658305 CACTTAAACCTGGGAGGCGGAGG + Intergenic
928183903 2:29091935-29091957 CACTTAAACCTGGGAGGTGGAGG + Intergenic
928440769 2:31290066-31290088 CACTTGAACCTGGCGGGCAGAGG + Intergenic
928510278 2:31996458-31996480 CACTTGAACCTGGCAGGCGGAGG + Intronic
928681886 2:33711051-33711073 CACTTAAACCTGGGAGGCGGAGG + Intergenic
928965346 2:36969911-36969933 CACTTGAACCTGGGAGGAGGAGG + Intronic
929141414 2:38669787-38669809 CACTTAAACCTGGGTGGTGGAGG + Intronic
929190842 2:39137934-39137956 CATTTGAACCTGGGAGGAGGAGG + Intergenic
929467400 2:42157520-42157542 CACTTAAACCTGGCAGGTGGAGG - Intergenic
929495543 2:42439343-42439365 TACTTAAACCTGGCAGGTGGAGG - Intergenic
929512363 2:42574518-42574540 CACTTGAACCTGGGAGGAGGAGG - Intronic
929581838 2:43086286-43086308 CACTTGAACCTGGGAGGAGGAGG - Intergenic
929837177 2:45413846-45413868 CACTTAAACCTGGCAGGCGGCGG + Intronic
929855735 2:45637250-45637272 CACTTGAACCTGGGAGGAGGAGG + Intergenic
930121825 2:47766929-47766951 CACTTGAACCTGGCAGGCGGAGG + Intronic
930346772 2:50192688-50192710 CATTTGAACCTGGGAGGAGGAGG - Intronic
930633770 2:53782868-53782890 CACTTAAACCTGGGAGGCGGAGG - Intronic
930777444 2:55187526-55187548 CACTTGAACCTGGGAGGAGGAGG + Intronic
931066680 2:58595706-58595728 CACTTAAACCTGGGAGGTGGAGG - Intergenic
931142130 2:59472506-59472528 CATTTAAACCTGGGAGGCGGAGG + Intergenic
931479265 2:62623192-62623214 CACTTGAACCTGGGAGGAGGAGG - Intergenic
931552013 2:63456926-63456948 CACTTAAACCTGGGAGGTGGAGG + Intronic
931727320 2:65123740-65123762 CACTTAAACCTGGAAGGCGGAGG + Intronic
931983800 2:67722201-67722223 CTGTTAAAGCAGGCAGGAGGGGG + Intergenic
932046899 2:68358848-68358870 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
932237300 2:70130843-70130865 CACTTGAACCTGGAGGGCGGAGG + Intergenic
932727362 2:74190838-74190860 CACTTGAACCTGGCAGGCGGAGG + Intergenic
933402905 2:81821259-81821281 CACTTAAACCTGGGAGGTGGAGG + Intergenic
933738470 2:85514091-85514113 CACTTGAACCTGGAGGGTGGAGG - Intergenic
933830179 2:86200760-86200782 CACTTAAACCTGGGAGGAGGAGG - Intronic
934058420 2:88271704-88271726 CACTTAAACCTGGCAGGCAGAGG - Intergenic
934081591 2:88472890-88472912 CATTTAAACCCGGGGGGTGGAGG + Intergenic
934680619 2:96281248-96281270 CAGTTAAACCTGGGAGGCAGAGG - Intronic
934850008 2:97692491-97692513 CACTTGAACCTGGGAGGAGGAGG - Intergenic
934994442 2:98944525-98944547 CACTTGAACCTGGGGGGTGGAGG - Intergenic
935012518 2:99149085-99149107 CACTTTAACCTGCCGGGTGGAGG + Intronic
935204450 2:100885756-100885778 CACTTGAACCTGGCTGGGGGAGG - Intronic
936342717 2:111650543-111650565 CACTTAAACCTGGGAGGTGGAGG + Intergenic
936450856 2:112633018-112633040 CACTTGAACCTGGGAGGAGGAGG + Intergenic
936989020 2:118342466-118342488 CACTTGAACCTGGAAGGAGGAGG + Intergenic
937198632 2:120182121-120182143 CATTTAAACAGGGAGGGAGGAGG - Intergenic
937385010 2:121421624-121421646 CACTTAAACCTGGAAGGCGGAGG - Intronic
937425610 2:121796114-121796136 CACTTAAACCTGGGAGGCGGAGG + Intergenic
938121290 2:128636040-128636062 CACTTGAACCTGGCAGGAGGAGG - Intergenic
938868655 2:135451476-135451498 CATTTAAACCTGGGAGGCGGAGG + Intronic
938890304 2:135697967-135697989 CACTTAAACCTGGGAGGCGGAGG + Intronic
939050101 2:137297840-137297862 CAGTTCCACGTGGCTGGAGGAGG - Intronic
939337536 2:140849621-140849643 CACTTGAACCTGGCAGGCGGAGG - Intronic
939384191 2:141475281-141475303 CATTTAAACCTGGGAGGGGGAGG + Intronic
939415180 2:141887077-141887099 CACTTGAACCTGGCAGGTGGAGG - Intronic
940459142 2:153940339-153940361 CACTTGAACCTGGGGGGCGGAGG - Intronic
940524734 2:154799213-154799235 CATTTGAACCTGGGAGGAGGAGG - Intronic
940589012 2:155697151-155697173 CACTTGAACCTGGGAGGAGGAGG - Intergenic
940909143 2:159195202-159195224 CACTTAAACCTGGGAGGTGGAGG - Intronic
940924951 2:159354432-159354454 CAGTTGAACCTGGGAGGTGGAGG - Intronic
941360074 2:164540523-164540545 CACTTGAACCTGGGGGGTGGAGG + Intronic
941391459 2:164920188-164920210 CACTTGAACCTGGGGGGTGGAGG + Intronic
941568451 2:167138981-167139003 CACTTGAACCTGGCAGGTGGAGG + Intronic
941826127 2:169899060-169899082 CAGTTGAACCTGGAAGGCGGAGG - Intronic
941874981 2:170423063-170423085 CACTTGAACCTGGGGGGCGGAGG - Intronic
941966166 2:171303273-171303295 CACTTGAACCTGGGAGGAGGAGG - Intergenic
942811330 2:180004473-180004495 CACTTAAACCTGGGAGGCGGAGG - Intronic
943207581 2:184920029-184920051 CAGTTGAACCTGGGAGGAGGAGG + Intronic
943481082 2:188418547-188418569 CAGTTGAACCTGGGAGGTGGAGG + Intronic
944041596 2:195361977-195361999 CACTTAAACCTGGAAGGTGGAGG - Intergenic
944231159 2:197394098-197394120 CACTTGAACCTGGGGGGTGGAGG + Intronic
944416797 2:199487183-199487205 CACTTGAACCTGGGAGGAGGTGG - Intergenic
944586209 2:201176021-201176043 CAGTTGAACCTGGGAGGCGGAGG + Exonic
944979964 2:205106229-205106251 CACTTGAACCTGGGGGGCGGAGG - Intronic
945281011 2:208035645-208035667 CACTTAAACCTGGGAGGCGGAGG - Intergenic
945407960 2:209472664-209472686 CCCTTAAACCTTGAGGGAGGAGG + Intronic
945474219 2:210262885-210262907 CACTTAAACCTGGGAGGCGGAGG - Intergenic
945489820 2:210441986-210442008 CACTTAAACCTGGGAGGCGGAGG - Intronic
945832592 2:214805075-214805097 CACTTGAACCTGGCAGGCGGAGG + Intronic
945996722 2:216443281-216443303 CACTTAAACCTGGGAGGTGGAGG + Intronic
946240999 2:218355684-218355706 CACTTGAACCTGGCAGGAGGAGG + Intergenic
946390158 2:219410271-219410293 CACTTGAACCTGGCGGGTGGAGG - Intergenic
946550769 2:220799909-220799931 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
946902059 2:224382491-224382513 CACTTGAACCTGGCAGGTGGAGG - Intronic
947177233 2:227380244-227380266 CACTTGAACCTGGGGGGTGGAGG + Intronic
947428273 2:230003614-230003636 CAGTTGAACCTGGGAGGTGGAGG - Intronic
947630299 2:231648356-231648378 CACTTAAACCTGGGAGGTGGAGG + Intergenic
947699626 2:232221715-232221737 CAGTTGAACCTGGGAGGTGGAGG + Intronic
947708808 2:232297784-232297806 CGTTTGAACCTGGCGGGTGGAGG - Intronic
947836306 2:233178564-233178586 CACTTGAACCTGGCAGGCGGAGG - Intronic
947850975 2:233287792-233287814 CACTTAAACCTGGGAGGCGGAGG + Intronic
947854782 2:233315784-233315806 CAGTTAAACCTGGGAGGCGGAGG - Intronic
947900165 2:233714958-233714980 CAGTTGAACCTGGGAGGTGGAGG - Intronic
948042595 2:234915164-234915186 CACTTAAACCTGGGAGGCGGAGG - Intergenic
948210901 2:236192452-236192474 CAGCTAAGCCTGGTGGGTGGGGG + Intergenic
948356529 2:237382297-237382319 CACTTGAACCTGGAAGGAGGAGG + Intronic
948410047 2:237752320-237752342 CACTTGAACCTGGCAGGTGGAGG + Intronic
948746466 2:240098002-240098024 CATTTGAACCTGGGAGGAGGAGG + Intergenic
948890313 2:240904192-240904214 CACTTGAACCTGGTGGGGGGAGG + Intergenic
948960469 2:241331471-241331493 CACTTAAACCTGGGAGGTGGAGG - Intronic
1168776073 20:448603-448625 CACTTAAACCTGGGAGGCGGAGG + Intronic
1169423516 20:5478236-5478258 CACTTGAACCTGGTGGGAGGAGG + Intergenic
1169450042 20:5703011-5703033 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1169533083 20:6506233-6506255 CACTTTAACCTGGGGGGTGGAGG + Intergenic
1170252666 20:14302737-14302759 CATTTGAACCTGGCAGGCGGAGG - Intronic
1170873514 20:20230637-20230659 CGCTTGAACCTGGGGGGAGGCGG - Intronic
1171098788 20:22361488-22361510 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1171200771 20:23240329-23240351 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1171225756 20:23440838-23440860 CACTTGAACCTGGGAGGAGGAGG - Intronic
1171305075 20:24098316-24098338 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1171526923 20:25820917-25820939 CAGTTGAACCTGGGAGGTGGTGG - Intronic
1171549904 20:26034968-26034990 CAGTTGAACCTGGGAGGTGGTGG + Intergenic
1172411957 20:34731101-34731123 CACTTAAACCTGGGAGGCGGAGG - Intronic
1172415886 20:34767377-34767399 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1172525427 20:35598296-35598318 CACTTGAACCTGGCAGGTGGAGG - Intergenic
1172526969 20:35605727-35605749 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1172531564 20:35634508-35634530 CGCTTGAACCTGGCGGGTGGAGG + Intronic
1172592918 20:36130023-36130045 CACTTGAACCTGGGGGGCGGAGG - Intronic
1172661239 20:36570497-36570519 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1172670946 20:36634069-36634091 CACTTGAACCTGGGAGGAGGAGG - Intronic
1172682931 20:36730852-36730874 CACTTAAAACTGGGAGGAGGAGG + Intronic
1172858365 20:38026241-38026263 CATTTGAACCTGGCAGGCGGAGG - Intronic
1173286656 20:41678159-41678181 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1173507773 20:43602246-43602268 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1173999848 20:47366526-47366548 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1174021703 20:47535589-47535611 CACTTGAACCTGGGAGGAGGAGG - Intronic
1174186998 20:48713038-48713060 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1174270916 20:49367685-49367707 CACTTGAACCTGGGTGGAGGAGG + Exonic
1174589044 20:51630615-51630637 CACTTAAACCTGGGAGGCGGAGG + Intronic
1174798541 20:53542997-53543019 CACTTGAACCTGGCAGGTGGAGG - Intergenic
1175098739 20:56562893-56562915 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1175128138 20:56767710-56767732 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1175849506 20:62081555-62081577 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1176341490 21:5701286-5701308 CAGTTGAACCTGGGAGGAGGAGG - Intergenic
1176473744 21:7133439-7133461 CAGTTGAACCTGGGAGGAGGAGG - Intergenic
1176503337 21:7623170-7623192 CAGTTGAACCTGGGAGGAGGAGG + Intergenic
1176515955 21:7783633-7783655 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1176786533 21:13263025-13263047 CACTTGAACCTGGAAGGAGGAGG - Intergenic
1177060638 21:16369462-16369484 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1177064563 21:16413376-16413398 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1177876950 21:26645447-26645469 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1177937562 21:27368135-27368157 CATTTAAACCTGGGAGGCGGAGG + Intergenic
1178232714 21:30805151-30805173 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1178255020 21:31044477-31044499 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1178401033 21:32284683-32284705 CATTTGAACCTGGAGGGTGGAGG + Intergenic
1178493013 21:33065774-33065796 CATTTGAACCTGGGGGGCGGAGG + Intergenic
1178548255 21:33512198-33512220 CACTTAAACCTGGGAGGTGGAGG + Intronic
1178649983 21:34413645-34413667 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1178820266 21:35968317-35968339 CAATTGAACCTGGGGGGTGGAGG + Intronic
1178974488 21:37209395-37209417 CAGTGAAACCAGGTGTGAGGAGG - Intergenic
1179454049 21:41486381-41486403 CACTTGAACCTGGGAGGAGGGGG - Intronic
1179584971 21:42368800-42368822 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1180925078 22:19548189-19548211 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1181543377 22:23586625-23586647 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1181652506 22:24268049-24268071 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1181832919 22:25577254-25577276 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1181928112 22:26376663-26376685 CACTTGAACCTGGGAGGAGGAGG + Intronic
1181945025 22:26509770-26509792 CACTTAAACCTGGAAGGTGGAGG + Intronic
1182054340 22:27338231-27338253 CACTTGAACCTGGAGGGCGGAGG - Intergenic
1182083601 22:27545997-27546019 CAATAAAACTTGGCTGGAGGAGG - Intergenic
1182196205 22:28520967-28520989 CACTTGAACCTGGCAGGCGGAGG + Intronic
1182231826 22:28843548-28843570 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1182542304 22:31050524-31050546 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1182645012 22:31801210-31801232 CACTTAAACCTGGGAGGTGGAGG + Intronic
1182672811 22:32011361-32011383 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1182757260 22:32690090-32690112 CACTTAAACCTGGGAGGTGGAGG + Intronic
1182901691 22:33903739-33903761 CACTTGAACCTGGGAGGAGGAGG + Intronic
1182904787 22:33926131-33926153 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1183090184 22:35517109-35517131 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1183273249 22:36875111-36875133 CACTTGAACCTGGCAGGTGGAGG - Intronic
1183626535 22:39006373-39006395 CTGTTAAACCTGGGAGGTGGAGG + Intergenic
1183779019 22:39986750-39986772 CACTTAAACCTGGGGGATGGAGG + Intergenic
1183843054 22:40516334-40516356 CACTTGAACCTGGCAGGTGGGGG + Intronic
1183898371 22:40987119-40987141 CACTTAAACCTGGAAGGCGGAGG + Intergenic
1183930309 22:41232246-41232268 CACTTGAACCTGGGGGGCGGAGG + Intronic
1184063525 22:42101024-42101046 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1184118752 22:42437224-42437246 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1184398417 22:44259352-44259374 CACTTAAACCTGGGAGGCGGAGG + Intronic
1184427140 22:44417153-44417175 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1184470947 22:44696005-44696027 CACTTAAACCTGGGAGGTGGAGG - Intronic
1184630557 22:45774847-45774869 CACTTAAACCTGGGAGGTGGAGG + Intronic
1203240755 22_KI270733v1_random:15753-15775 CAGTTGAACCTGGGAGGAGGAGG - Intergenic
949519977 3:4842449-4842471 CACTTAAACCTGGGAGGTGGAGG - Intronic
949794646 3:7835073-7835095 CAGTGATACCGGGCGGGGGGGGG - Intergenic
950020375 3:9783401-9783423 CAGTTGAACCTGGGAGGCGGAGG - Intronic
950245564 3:11414147-11414169 CACTTGAACCTGGGAGGAGGTGG - Intronic
950401508 3:12772567-12772589 CACTTAAACCTGGCAGGCAGAGG + Intergenic
951346319 3:21550564-21550586 CACTTGAACCTGGCAGGCGGAGG - Intronic
951354552 3:21648349-21648371 CAGTTCCACATGGCTGGAGGAGG - Intronic
951881112 3:27482686-27482708 CGGTTGAACCTGGGAGGAGGAGG + Intronic
951922038 3:27865517-27865539 CATTTAAACCTGGGAGGTGGAGG + Intergenic
951962141 3:28339062-28339084 CACTTAAACCTGGGAGGCGGAGG - Intronic
952176235 3:30866373-30866395 CAGTTGAACCTGGGAGGAGAAGG + Intronic
952313463 3:32211494-32211516 CACTTCAACCTGGGAGGAGGAGG - Intergenic
952408028 3:33022653-33022675 CACTTGAACCTGGGAGGAGGAGG - Intronic
953150111 3:40316870-40316892 CAGTTAAACCAGGGAGGCGGAGG + Intergenic
953288678 3:41639642-41639664 CACTTAAACCTGGGAGGCGGAGG + Intronic
953397566 3:42585043-42585065 CACTTGAACCTGGGAGGAGGAGG + Intronic
953473507 3:43186158-43186180 CACTTTAACCAAGCGGGAGGAGG + Intergenic
954076359 3:48184276-48184298 CAGTTGAACCTGGGAGGTGGAGG + Intronic
954165963 3:48758172-48758194 CACTTAAACCTGGGAGGTGGAGG + Intronic
954311176 3:49768684-49768706 CACTTAAACCTGGGAGGCGGAGG + Intronic
954347796 3:50015189-50015211 CACTTGAACCTGGCAGGCGGGGG - Intronic
954386122 3:50245080-50245102 CACTTAAACCTGGGAGGCGGAGG - Intronic
954573367 3:51660703-51660725 CACTTGAACCTGGGAGGAGGAGG - Intronic
955199123 3:56833985-56834007 CACTTAAACCTGGGAGGTGGAGG - Intronic
955306992 3:57843862-57843884 CACTTAAACCTGGGAGGTGGAGG - Intronic
955417497 3:58706155-58706177 CACTTAAACCTGGTGGGTGGAGG - Intergenic
955419404 3:58721649-58721671 CAGACAAATCTGGAGGGAGGGGG + Intronic
955615051 3:60798839-60798861 CACTTGAACCTGGGAGGAGGAGG - Intronic
956289171 3:67643758-67643780 CAGTTGAACCTGGGAGGCGGAGG - Intronic
956363795 3:68477456-68477478 CACTTAAACCTGGGAGGTGGAGG - Intronic
956834012 3:73080986-73081008 CACTTGAACCTGGGAGGAGGAGG - Intergenic
957298664 3:78363164-78363186 CACTTGAACCTGGCAGGTGGAGG - Intergenic
957437219 3:80194093-80194115 CAGTTCAACCTGGCAGGCGGAGG - Intergenic
957523917 3:81356376-81356398 CATTTAAACCTGGGAGGTGGTGG - Intergenic
957865781 3:86021081-86021103 CACTTAAACCTGGGAGGCGGAGG - Intronic
958043526 3:88254792-88254814 CACTTGAACCTGGGGGGTGGAGG - Intergenic
958741588 3:98080209-98080231 CACTTAAACCTGGGAGGCGGAGG - Intergenic
958757583 3:98269803-98269825 CACTTGAACCTGGAGGGTGGTGG - Intergenic
959001324 3:100967418-100967440 CACTTGAACCTGGAAGGAGGAGG + Intronic
960136737 3:114113208-114113230 CACTTGAACCTGGGTGGAGGAGG + Intergenic
960152346 3:114262838-114262860 CACTTGAACCTGGGAGGAGGAGG + Intergenic
960530257 3:118756127-118756149 CACTTAAACCTGGGAGGCGGAGG + Intergenic
960910899 3:122648518-122648540 CACTTGAACCTGGGAGGAGGAGG - Intergenic
960992199 3:123319268-123319290 CACTTGAACCTCGGGGGAGGAGG + Intronic
961185661 3:124912850-124912872 CACTTGAACCTGGGGGGTGGAGG + Intronic
961679126 3:128586989-128587011 CACTTGAACCTGGCGGGTGGAGG + Intergenic
962100225 3:132333985-132334007 CACTTAAACCTGGGAGGTGGAGG + Intronic
962298561 3:134215950-134215972 CACTTGAACCTGGGGGGCGGAGG + Intronic
963100078 3:141593129-141593151 CACTTAAACCTGGGAGGTGGAGG - Intronic
963134170 3:141885530-141885552 CACTTAAACCTGGGAGGCGGAGG - Intronic
963348131 3:144120930-144120952 CAGTTGAACCTGGGGGGCGGAGG - Intergenic
963555245 3:146779265-146779287 CACTTAAACTTGGAGGGTGGAGG - Intergenic
963628765 3:147707575-147707597 CACTTAAACCTGGGAGGTGGAGG - Intergenic
964211879 3:154237456-154237478 CACTTAAACCTGGCAGGCGGAGG + Intronic
964361278 3:155899282-155899304 CACTTAAACCTGGGAGGCGGAGG + Intronic
964472758 3:157071730-157071752 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
964489284 3:157217765-157217787 CACTTGAACCTGGCAGGCGGAGG - Intergenic
964777070 3:160290322-160290344 CACTTGAACCTGGGAGGAGGAGG + Intronic
964857892 3:161166961-161166983 CACTTGAACCTGGGAGGAGGAGG - Intronic
965344918 3:167536594-167536616 CACTTGAACCTGGCAGGTGGAGG + Intronic
965559777 3:170050141-170050163 CACTTAAACCTGGGAGGTGGAGG - Intronic
966713958 3:182997299-182997321 CACTTGAACCTGGCAGGGGGAGG - Intergenic
966907062 3:184534129-184534151 CACTTAAACCTGGGAGGTGGAGG + Intronic
967031046 3:185607410-185607432 CACTTGAACCTGGCAGGTGGAGG - Intronic
967063156 3:185890362-185890384 CACTTGAACCTGGGAGGAGGAGG + Intergenic
967097086 3:186186012-186186034 CACTTGAACCTGGGAGGAGGAGG + Intronic
967188566 3:186965980-186966002 CACTTAAACCTGGGAGGCGGAGG - Intronic
967567022 3:190985556-190985578 CACTTAAACCTGGGAGGCGGAGG - Intergenic
967794888 3:193589054-193589076 CACTTAAACCTGGGAGGTGGAGG + Intronic
967819988 3:193831524-193831546 CAGTGAAACCTGGCTGGGGAGGG + Intergenic
967839359 3:193992382-193992404 CAGTCAGCCCTGGAGGGAGGGGG - Intergenic
968136634 3:196224590-196224612 CACTTAAACCTGGGAGGTGGAGG + Intronic
968200633 3:196751824-196751846 CACTTGAACCTGGGAGGAGGAGG - Intronic
968638764 4:1698566-1698588 CACTTGAACCTGGGAGGAGGAGG - Intronic
968759215 4:2433414-2433436 CAGTTACACGGGGCGGGGGGGGG + Intronic
969038162 4:4272906-4272928 CACTCATACCTGTCGGGAGGTGG - Intronic
969382824 4:6817298-6817320 CACTTGAACCTGGGAGGAGGAGG - Intronic
969916970 4:10500594-10500616 CACTTGAACCTGGGAGGAGGAGG + Intronic
970004222 4:11395559-11395581 CACTTGAACCTGGCAGGTGGAGG - Exonic
971336726 4:25730040-25730062 CACTTGAACCTGGCAGGTGGAGG - Intergenic
971590076 4:28456213-28456235 CATTTAAACCTGGGAGGTGGAGG + Intergenic
971662956 4:29443740-29443762 CACTTAAACCTGGGAGGTGGAGG + Intergenic
971731407 4:30386976-30386998 CGCTTGAACCTGGCAGGAGGAGG - Intergenic
972393129 4:38631945-38631967 CACTTAAACCCGGGAGGAGGAGG + Intergenic
972424416 4:38919067-38919089 CACTTGAACCTGGGGGGCGGAGG + Intronic
972514164 4:39796750-39796772 CACTTGAACCTGGCAGGTGGAGG + Intergenic
972589684 4:40472476-40472498 CACTTAAACCTGGGAGGTGGAGG + Intronic
972695416 4:41440614-41440636 CACTTAAACCTGGGAGGTGGAGG - Intronic
972849257 4:43028023-43028045 CACTTGAACCTGGGAGGAGGAGG + Intronic
972949835 4:44305001-44305023 CAAATAAACCTGGTGGGAGAAGG + Intronic
973124229 4:46564470-46564492 CAATTAAACCTGGGAGGCGGAGG - Intergenic
973212710 4:47634548-47634570 CACTTAAACCTGGGAGGTGGAGG + Intronic
973807305 4:54538811-54538833 CACTTGAACCTGGGGGGTGGAGG - Intergenic
973885499 4:55316669-55316691 CACTTAAACCTGGGAGGCGGAGG + Intergenic
973920285 4:55677020-55677042 CACTTGAACCTGGGGGGTGGAGG + Intergenic
974054062 4:56967999-56968021 CACTTAAACCTGGGAGGCGGAGG - Intronic
974298573 4:60035655-60035677 CACTTGAACCTGGGGGGTGGAGG - Intergenic
974362938 4:60906453-60906475 CAGTTAATCCTGGAGGGCTGAGG - Intergenic
975146333 4:70971410-70971432 CACTTAAACCTGGGAGGTGGGGG + Intronic
975156286 4:71076446-71076468 CACTTAAACCCGGGAGGAGGAGG + Intergenic
976237181 4:82910902-82910924 GAGGTAAACCTGGCTGGAGTGGG + Intronic
976260565 4:83141081-83141103 CACTTGAACCTGGCAGGCGGAGG + Intergenic
977936702 4:102814370-102814392 CACTTGAACCTGGGAGGAGGAGG - Intronic
978360325 4:107924740-107924762 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
978436075 4:108685972-108685994 CACTTGAACCTGGGAGGAGGAGG - Intergenic
978477631 4:109148792-109148814 CAGTTAGACCTGGCTGGAGGAGG - Intronic
978703233 4:111674465-111674487 CACTTAAACCTGGGAGGTGGAGG + Intergenic
978983421 4:114980556-114980578 CACTTAAACCTGGGAGGTGGAGG + Intronic
979881961 4:125970949-125970971 CTTTTAAACCTGGCTGGAGCTGG + Intergenic
979882855 4:125984467-125984489 CGCTTAAACCTGGGGGGTGGAGG + Intergenic
980779402 4:137477870-137477892 CAATTAAACCTGGGAGGTGGAGG + Intergenic
980783085 4:137516986-137517008 CACTTGAACCTGGGGGGTGGAGG - Intergenic
980922242 4:139098550-139098572 CATTTGAACCTGGAGGGTGGAGG - Intronic
980939604 4:139261004-139261026 CCCTTGAACCTGGGGGGAGGAGG + Intergenic
981203365 4:142010176-142010198 CACTTGAACCTGGGGGGCGGGGG - Intergenic
981881647 4:149620071-149620093 CACTTAAACCCGGCAGGTGGAGG + Intergenic
982298373 4:153853602-153853624 CATTTGAACCTGGAGGGTGGAGG - Intergenic
982663665 4:158234454-158234476 CACTTGAACCTGGGAGGAGGAGG + Intronic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
983153096 4:164310159-164310181 CAGTTGAACCTGGGAGGTGGAGG - Intronic
983196242 4:164809983-164810005 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
983279929 4:165667347-165667369 CACTTGAACCTGGCAGGCGGAGG + Intergenic
983433798 4:167685235-167685257 GAGTTAAACCTGGAGGTAGAGGG - Intergenic
984029191 4:174582390-174582412 CACTTGAGCCTGGCGGGTGGAGG - Intergenic
984153198 4:176160403-176160425 CACTTAAACCTGGGAGGTGGAGG - Intronic
984247832 4:177296591-177296613 CACTTGAACCTGGGAGGAGGAGG + Intergenic
984267861 4:177515718-177515740 CAGTTGAACCTGGAAGGCGGAGG + Intergenic
984378162 4:178957918-178957940 CACTTAAACCTGGGAGGTGGAGG - Intergenic
984790391 4:183609632-183609654 CACTTGAACCTGGAGGGCGGAGG + Intergenic
984828304 4:183948132-183948154 CACTTGAACCTGGCAGGTGGAGG + Intronic
984946839 4:184975544-184975566 CATTTGAACCTGGGAGGAGGAGG - Intergenic
984971600 4:185196388-185196410 CACTTGAACCTGGCAGGCGGAGG + Intronic
985163201 4:187064729-187064751 CACTTGAACCTGGAGGGCGGAGG + Intergenic
986108267 5:4682476-4682498 CACTTCAACCTGGGGGGCGGAGG + Intergenic
986462756 5:7990007-7990029 CACTTGAACCTGGGAGGAGGAGG - Intergenic
986692608 5:10326153-10326175 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
986712286 5:10496752-10496774 CACTTGAACCTGGGAGGAGGAGG + Intergenic
987269045 5:16286155-16286177 CACTTGAACCTGGAAGGAGGAGG + Intergenic
987537164 5:19204329-19204351 CAGTTGAACCTGGAAGGTGGAGG - Intergenic
987592718 5:19952130-19952152 CACTTGAACCTGGGAGGAGGAGG - Intronic
987716304 5:21577070-21577092 CGGTTGAACCTGGGGGGTGGAGG - Intergenic
987866150 5:23542116-23542138 CACTTGAACCTGGGAGGAGGAGG - Intergenic
988192057 5:27950012-27950034 CACTTGAACCTGGGAGGAGGAGG + Intergenic
988525738 5:31985607-31985629 CACTTGAACCTGGCAGGTGGAGG + Intronic
988559009 5:32263519-32263541 CACTTTAACCTGGCAGGCGGAGG - Intronic
988932988 5:36055053-36055075 CGCTTAAACCTGGGAGGAGGAGG + Intronic
989051180 5:37321937-37321959 CACTTAAACCTGGGAGGCGGAGG - Intronic
989173551 5:38497197-38497219 CACTTGAACCTGGCAGGTGGAGG + Intronic
989221532 5:38971089-38971111 CACTTAAACCTGGGAGGTGGAGG - Intronic
989594581 5:43144310-43144332 CACTTGAACCTGGCAGGCGGAGG - Intronic
990003245 5:50919819-50919841 CACTTAAACCTGGGAGGTGGAGG + Intergenic
990209867 5:53470990-53471012 CACTTAAACCTGGGAGGTGGAGG - Intergenic
990484406 5:56243573-56243595 CACTTGAACCTGGGGGGCGGAGG - Intergenic
991175502 5:63682942-63682964 CACTTAAACCTGGGAGGCGGAGG + Intergenic
991394553 5:66190695-66190717 CAATTGAACCTGGGAGGAGGAGG - Intergenic
991711762 5:69415320-69415342 GAGCGAAACCTGGCGGGACGCGG - Intronic
991907510 5:71526769-71526791 CACTTAAACCTGGGAGGTGGAGG - Intronic
991964793 5:72080232-72080254 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
992454768 5:76906714-76906736 CACTTGAACCTGGGAGGAGGAGG - Intronic
992692406 5:79254029-79254051 CATTTGAACCTGGGAGGAGGAGG - Intronic
992759281 5:79937379-79937401 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
993645341 5:90454636-90454658 CACTTAAACCTGGGAGGCGGAGG + Intergenic
993690385 5:90993240-90993262 CACTTGAACCTGGGAGGAGGAGG - Intronic
993930555 5:93933920-93933942 CACTTGAACCTGGCAGGCGGAGG + Intronic
994514348 5:100752074-100752096 CACTTGAACCTGGCAGGCGGAGG - Intergenic
994580986 5:101641503-101641525 CACTTGAACCTGGGAGGAGGAGG + Intergenic
994599268 5:101881518-101881540 CACTTGAACCTGGCAGGTGGAGG + Intergenic
995094907 5:108224673-108224695 CAGTTGAACCTGGGAGGCGGAGG - Intronic
995909500 5:117168541-117168563 CACTTGAACCTGGGAGGAGGAGG + Intergenic
996368438 5:122727625-122727647 CACTTAAACCTGGCAGGTGGAGG - Intergenic
996376540 5:122814831-122814853 CATTTGAACCTGGAGGGTGGAGG - Intronic
996414540 5:123195959-123195981 CAGTTCTCCCTGGAGGGAGGAGG + Intergenic
997026832 5:130074152-130074174 CACTTGAACCTGGAAGGAGGAGG - Intronic
997500150 5:134367455-134367477 CACTTAAACCTGGAAGGAGGAGG - Intronic
997928036 5:138049023-138049045 CACTTGAACCTGGGAGGAGGAGG - Intronic
997936637 5:138117898-138117920 CACTTGAACCTGGGGGGCGGAGG + Intronic
998003514 5:138642385-138642407 CGCTTGAACCTGGCGGGCGGAGG + Intronic
998015698 5:138730273-138730295 CTCTTGAACCTGGCGGGTGGAGG + Intronic
998410289 5:141904934-141904956 CACTTAAGCCTGGCAGGCGGGGG + Intergenic
998776683 5:145611245-145611267 CACTTGAACCTGGGAGGAGGAGG - Intronic
999495843 5:152095970-152095992 CACTTGAACCTGGGAGGAGGAGG + Intergenic
999681471 5:154064248-154064270 CACTTGAACCTGGGAGGAGGAGG - Intronic
999750695 5:154626349-154626371 CACTTGAACCTGGGAGGAGGAGG + Intergenic
999976291 5:156915331-156915353 CGGTTGAACCTGGGAGGAGGAGG - Intergenic
1000076854 5:157797467-157797489 CACTTAAACCTGGCAGGCGGAGG - Intronic
1000274439 5:159720764-159720786 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1000314940 5:160081320-160081342 CACTTGAACCTGGGAGGAGGAGG - Intronic
1000429564 5:161135246-161135268 CACTTAAACCTGACAGGCGGAGG + Intergenic
1000437040 5:161225100-161225122 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1000783605 5:165514755-165514777 CACTTGAACCTGGAGGGCGGAGG + Intergenic
1000987805 5:167880114-167880136 CACTTGAACCTGGGGGGCGGAGG - Intronic
1001032281 5:168271622-168271644 CACTTAAACCTGGGAGGAGGAGG + Intergenic
1001065954 5:168535382-168535404 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1001258450 5:170203860-170203882 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1001575574 5:172761805-172761827 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1001622482 5:173099988-173100010 CATTCAAACCTGGGAGGAGGAGG - Intronic
1001862885 5:175074069-175074091 CACTTGAACCTGGCGGGAGGAGG + Intergenic
1001930485 5:175669445-175669467 CACTTGAACCTGGCAGGCGGAGG - Intronic
1002114309 5:176946426-176946448 CACTTAAACCTGGGAGGCGGAGG + Intronic
1002224026 5:177705218-177705240 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1002456454 5:179347883-179347905 CAGTTAAACCCTCAGGGAGGTGG + Intergenic
1002485608 5:179533897-179533919 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1002527569 5:179823378-179823400 CACTTAAACCTGGAGAGCGGAGG + Intronic
1002591357 5:180293005-180293027 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1002719984 5:181253117-181253139 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1003132308 6:3405175-3405197 CACTTGAACCTGGGGGGCGGAGG + Intronic
1003582941 6:7359128-7359150 CACTTGAACCTGGGAGGAGGAGG - Intronic
1003735328 6:8871981-8872003 CATTTGAACCTGGTAGGAGGGGG - Intergenic
1003774591 6:9346437-9346459 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1003950884 6:11114680-11114702 CACTTAAGCCTGGGAGGAGGAGG - Intronic
1004120804 6:12820262-12820284 CACTTGAACCTGGAGGCAGGGGG - Intronic
1004590076 6:17042094-17042116 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1004598041 6:17119614-17119636 CACTTGAACCTGGGAGGAGGAGG + Intronic
1004631521 6:17426009-17426031 CACTTGAACCTGGGAGGAGGAGG + Intronic
1004754222 6:18594053-18594075 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1004934708 6:20496225-20496247 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1005061875 6:21784167-21784189 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1005334556 6:24781118-24781140 CACTTAAACCTGGGAGGTGGAGG + Intronic
1005489603 6:26335105-26335127 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1006126641 6:31842956-31842978 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1006178484 6:32138662-32138684 CACTTGAACCTGGGGCGAGGAGG - Intergenic
1006182243 6:32161371-32161393 CACTTGAACCTGGCAGGCGGAGG - Intronic
1006183094 6:32165698-32165720 CACTTGAACCTGGGGGGCGGAGG + Intronic
1006348078 6:33499290-33499312 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1006468735 6:34213314-34213336 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1006488335 6:34363854-34363876 CGCTTAAACCTGGGAGGAGGAGG - Intronic
1006849624 6:37088556-37088578 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1007166504 6:39832196-39832218 CAGTTAAACCTGGGTGAAAGTGG + Intronic
1007173611 6:39881627-39881649 GAATTAAACCTGGGGGGCGGAGG + Intronic
1007456778 6:41984428-41984450 CACTTGAACCTGGGGGGCGGAGG - Intronic
1007534588 6:42574777-42574799 CACTTGAACCTGGCAGGTGGAGG - Intronic
1007536314 6:42593088-42593110 CACTTAAACCTGGGAGGCGGAGG + Intronic
1007689607 6:43691506-43691528 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1008611912 6:53192004-53192026 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1009902259 6:69821640-69821662 CACTTGAACCTGAAGGGAGGAGG + Intergenic
1010381193 6:75226961-75226983 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1010928617 6:81773410-81773432 CCTTTAATCTTGGCGGGAGGAGG - Intergenic
1011264907 6:85506398-85506420 CGCTTAAACCTGGGAGGAGGAGG - Intronic
1011468969 6:87688664-87688686 CACTTGAACCCGGGGGGAGGTGG + Intronic
1011653103 6:89525208-89525230 CACTTGAACCTGGGAGGAGGAGG + Intronic
1011675213 6:89726378-89726400 CAGTTGAACCTGGGAGGAGGAGG + Intronic
1012650765 6:101749894-101749916 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1012902605 6:105024070-105024092 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1012979120 6:105811500-105811522 CACTTGAACCTGGAGGGCGGAGG - Intergenic
1013040049 6:106424543-106424565 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
1013365008 6:109430508-109430530 CACTTAAACCTGGGAGGTGGAGG - Intronic
1013905304 6:115209916-115209938 CAATTGAACCTAGCAGGAGGAGG - Intergenic
1014252016 6:119125357-119125379 CACTTAAACCTGGGAGGCGGAGG - Intronic
1014809954 6:125874032-125874054 CAGTGAAATCTGGCCGGATGTGG + Intronic
1015553917 6:134441184-134441206 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1015621851 6:135140054-135140076 CACTTAAACCCGGCAGGTGGAGG + Intergenic
1016006499 6:139094306-139094328 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1016749278 6:147614383-147614405 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1016775981 6:147905263-147905285 CACTTGAACCTGGAGGGAGGCGG - Intergenic
1016933468 6:149431018-149431040 CACTTGAACCTGGTGGGGGGCGG - Intergenic
1016976675 6:149815660-149815682 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1017117144 6:150988688-150988710 CACTTAAACCTGGGAGGAGGAGG - Intronic
1017213432 6:151881797-151881819 CACTTGAACCTGGCAGGTGGAGG + Intronic
1017255938 6:152333714-152333736 CAATTGAACCTGGGAGGAGGAGG - Intronic
1017560625 6:155624726-155624748 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1017566753 6:155695253-155695275 CACTTAAACCTGGGGGGCAGAGG + Intergenic
1017807958 6:157962606-157962628 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1018057168 6:160062255-160062277 CACTTGAACCTGGGGGGCGGAGG - Intronic
1018324283 6:162648463-162648485 CACTTGAACCCGGCGGGCGGAGG - Intronic
1019115620 6:169759501-169759523 CACTTAAGCCTGGGAGGAGGAGG - Intronic
1019132628 6:169888471-169888493 CATTTGAACCTGGGGGGCGGAGG + Intergenic
1019415235 7:924011-924033 CAGTGTAACCTGGAGGGCGGGGG - Intronic
1019728489 7:2616676-2616698 CAGCTAGAACTGGCGAGAGGAGG + Intergenic
1019775958 7:2912407-2912429 CATTTAAACATGGCTGGAAGGGG - Intronic
1019836601 7:3391718-3391740 CACTTAAACCTGGCAAGCGGAGG - Intronic
1019939627 7:4279006-4279028 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1020147324 7:5654601-5654623 CACTTGAACCTGGCAGGTGGAGG + Intronic
1020172225 7:5853912-5853934 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1020203744 7:6099877-6099899 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1020292089 7:6730003-6730025 CAGGGGAACCGGGCGGGAGGTGG + Intergenic
1020425503 7:8061748-8061770 CACTTGAACCTGGGAGGAGGAGG - Intronic
1021280931 7:18717513-18717535 CACTTGAACCTGGGGGGCGGAGG - Intronic
1021484242 7:21149298-21149320 CAGATACACCTGGCTGGGGGAGG - Intergenic
1021522830 7:21554255-21554277 CACTTAAACCTGGGAGGTGGAGG - Intronic
1021987051 7:26107082-26107104 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1022141770 7:27499152-27499174 CACTTGAACCTGGAGGGTGGAGG + Intergenic
1022173576 7:27852213-27852235 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1022315422 7:29240967-29240989 CACTTAAACCTGGCAGGTGGAGG - Intronic
1022736046 7:33077117-33077139 CAGTAAAACCTGGCTGGGTGTGG - Intergenic
1022905757 7:34853880-34853902 CACTTAAACCTGGGAGGAGGAGG + Intronic
1023427079 7:40049109-40049131 CACTTAAACCTGGGAGGCGGAGG + Intronic
1023457733 7:40360095-40360117 CACTTGAACCTGGCAGGCGGAGG - Intronic
1023638700 7:42237590-42237612 CTGTTAAAACTTGGGGGAGGAGG - Intronic
1023714404 7:43028761-43028783 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1023786189 7:43710263-43710285 CACTTGAACCTGGGAGGAGGAGG + Intronic
1023860189 7:44213787-44213809 CAGGTAAACCAGCCAGGAGGTGG - Exonic
1023901879 7:44487868-44487890 CACTTGAACCTGGGAGGAGGAGG + Intronic
1024242141 7:47443835-47443857 CACTTGAACCTGGGAGGAGGAGG + Intronic
1024506994 7:50170252-50170274 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1024710696 7:52011564-52011586 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1025257900 7:57398165-57398187 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1025298746 7:57799012-57799034 CAGTTGAACCTGGGAGGTGGTGG + Intergenic
1025639850 7:63355890-63355912 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1025642849 7:63392202-63392224 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1025934926 7:66027848-66027870 CACTTAAACCTGGTAGGCGGAGG + Intergenic
1026000188 7:66555187-66555209 CACTTGAACCTGGTGGGTGGAGG - Intergenic
1026050019 7:66938589-66938611 CAGTTGAACCCGGAGGGCGGAGG - Intronic
1026089984 7:67291818-67291840 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1026166268 7:67912397-67912419 CACTTAAACCTGGGAGGAGGAGG + Intergenic
1026299853 7:69088018-69088040 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1026557081 7:71417870-71417892 CAGACAAAACTGGCTGGAGGTGG - Intronic
1026574948 7:71564368-71564390 CACTTGAACCTGGGAGGAGGAGG - Intronic
1026745573 7:73008896-73008918 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1026746468 7:73017039-73017061 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1026749226 7:73036838-73036860 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1026750119 7:73045182-73045204 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1026752874 7:73064983-73065005 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1026753767 7:73073292-73073314 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1026756525 7:73093109-73093131 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1026757418 7:73101328-73101350 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1026774282 7:73221434-73221456 CAGTTGAACCTGGAAGGCGGAGG - Intergenic
1026875636 7:73877571-73877593 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1026876910 7:73884688-73884710 CAGTGAAAGCTGATGGGAGGAGG - Intergenic
1026931977 7:74228090-74228112 CACTTGAACCTGGAAGGAGGAGG + Intronic
1026948526 7:74332155-74332177 CACTTGAACCTGGGGGGCGGAGG - Intronic
1027015139 7:74774820-74774842 CAGTTGAACCTGGAAGGCGGAGG - Intronic
1027031682 7:74893570-74893592 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1027032571 7:74901597-74901619 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1027051978 7:75026271-75026293 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1027072892 7:75171133-75171155 CAGTTGAACCTGGAAGGCGGAGG + Intergenic
1027089986 7:75292158-75292180 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1027090880 7:75300319-75300341 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1027093631 7:75320086-75320108 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1027094525 7:75328289-75328311 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1027097274 7:75348053-75348075 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1027098166 7:75356214-75356236 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1027231924 7:76277612-76277634 CACTTGAACCTGGCAGGTGGAGG + Intronic
1027233347 7:76284256-76284278 CACTTAAACCTGGGAGGTGGAGG - Intronic
1027322073 7:77019619-77019641 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1027324815 7:77039403-77039425 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1027325707 7:77047539-77047561 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1027366809 7:77467193-77467215 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1027906200 7:84185605-84185627 CACTTAAACCTGGGAGGTGGAGG + Intronic
1028228536 7:88277774-88277796 CACTTGAACCTGGGAGGAGGAGG + Exonic
1028579215 7:92387550-92387572 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1028798406 7:94931660-94931682 CACTTAAACCTGGGAGGTGGAGG - Intronic
1028883880 7:95910333-95910355 CAGTTAATCTGGGTGGGAGGAGG - Intronic
1029086444 7:98015586-98015608 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1029253644 7:99254163-99254185 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1029501230 7:100931507-100931529 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1029524452 7:101086475-101086497 CACTTGAACCTGGCAGGTGGAGG + Intronic
1029581307 7:101438275-101438297 CACTTAAACCTGGAAGGTGGAGG + Intronic
1029821166 7:103149169-103149191 CTGTTGGACCTCGCGGGAGGCGG - Exonic
1029871894 7:103703269-103703291 CAGCTACACCGGGCGGGAGTAGG - Intronic
1029989150 7:104947005-104947027 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1030056453 7:105587762-105587784 CACTTGAACCTGGGAGGAGGAGG - Intronic
1030352072 7:108500828-108500850 CAGTTGAACCTGGGAGGTGGAGG + Intronic
1030880207 7:114868268-114868290 CAATTAAACCTGGGAGGTGGAGG + Intergenic
1030920404 7:115377734-115377756 CACTTAGACCTGGGAGGAGGAGG - Intergenic
1031087553 7:117318619-117318641 CACTTGAACCTGGGAGGAGGAGG - Intronic
1031612940 7:123847692-123847714 CACTTGAACCTGGCAGGTGGAGG + Intronic
1031981336 7:128127742-128127764 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1032108254 7:129053239-129053261 CACTTGAACCTGGGAGGAGGAGG + Intronic
1032111886 7:129082929-129082951 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1033074687 7:138237390-138237412 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1033338910 7:140477012-140477034 CAATTAAACCTGGGAGGCGGGGG + Intronic
1033347667 7:140538588-140538610 CACTTAAACCTGGGAGGTGGAGG - Intronic
1033359806 7:140630775-140630797 CACTTAAACCTGGGAGGCGGAGG + Intronic
1033902066 7:146155781-146155803 CACTTGAACCTGGGAGGAGGAGG - Intronic
1034180290 7:149132276-149132298 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1034429057 7:151031713-151031735 CACTTGAACCTGGGAGGAGGAGG - Intronic
1034532359 7:151703976-151703998 CACTTGAACCTGGGGGGCGGAGG + Intronic
1034568854 7:151938349-151938371 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1034611471 7:152374230-152374252 CACTTGAACCTGGCAGGTGGAGG + Intronic
1034629489 7:152520117-152520139 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1035009528 7:155701769-155701791 CAGTTGAACCTGGGAGGCGGTGG - Intronic
1035142351 7:156775282-156775304 CACTTGAACCTGGGAGGAGGAGG + Intronic
1035211820 7:157334492-157334514 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1035912258 8:3580385-3580407 CAGGGATACCTGGGGGGAGGCGG + Intronic
1036000056 8:4592468-4592490 CGCTTAAACCTGGCAGGTGGAGG - Intronic
1036174141 8:6520477-6520499 CACTTAAACCTGGGAGGAGGAGG - Intronic
1036913343 8:12779274-12779296 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1037095236 8:14978385-14978407 CACTTAAACCTGGGAGGTGGAGG + Intronic
1037141665 8:15527298-15527320 CACTTAAACCTGGGAGGCGGAGG - Intronic
1037336035 8:17792778-17792800 CACTTAAACCTGGGAGGCGGAGG + Intronic
1037381169 8:18286841-18286863 CAATTAAACCTGGGAGGCGGAGG - Intergenic
1037559689 8:20061890-20061912 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1037834138 8:22206416-22206438 CACTTAAACCTGGGAGGTGGAGG + Intronic
1038345780 8:26731165-26731187 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1038549383 8:28452715-28452737 CACTTAAACCTGGAAGGCGGAGG + Intronic
1038741260 8:30219051-30219073 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1038841385 8:31187668-31187690 CACTTGAACCTGGAGGGTGGAGG + Intergenic
1039021914 8:33217290-33217312 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1039049422 8:33479326-33479348 CACTTGAACCAGGAGGGAGGTGG + Intronic
1039166088 8:34681640-34681662 CAGAAAACCCTGGTGGGAGGTGG - Intergenic
1039477469 8:37847611-37847633 CACTTAAACCTGGAAGGAGGAGG - Intronic
1039487740 8:37924875-37924897 CACTTGAACATGGCAGGAGGAGG - Intergenic
1039764383 8:40612894-40612916 CACTTGAACCTGGCAGGCGGAGG - Intronic
1039811870 8:41056338-41056360 GAGTTAGAACTGGAGGGAGGAGG + Intergenic
1039819532 8:41123800-41123822 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1039821873 8:41141948-41141970 CTGTTGAACCTGCCGGGAGATGG - Intergenic
1039932112 8:42002475-42002497 CACTTGAACCTGGGGGGTGGAGG + Intronic
1039992987 8:42505805-42505827 CAGTTGAACCTGGGAGGCGGGGG + Intronic
1040004401 8:42607383-42607405 CAGTTGAACCTGGGAGGCGGAGG - Intergenic
1040101301 8:43509212-43509234 CATTTGAACCTGGGAGGAGGAGG - Intergenic
1040453823 8:47575874-47575896 CACTTGAACCTGGCAGGCGGAGG + Intronic
1040715158 8:50242442-50242464 CACTTGAACCTGGCAGGTGGAGG + Intronic
1040886200 8:52266623-52266645 CACTTAAACCTGGGAGGTGGAGG - Intronic
1040947007 8:52894493-52894515 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1041056901 8:53995209-53995231 CATTTGAACCTGGGAGGAGGAGG + Intronic
1041249762 8:55922681-55922703 CACTTGAACCTGGCAGGCGGAGG + Intronic
1041347877 8:56920371-56920393 CAGTTAAACACTGAGGGAGGAGG + Intergenic
1041610860 8:59847077-59847099 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1042131441 8:65590519-65590541 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1042220734 8:66471177-66471199 CACTTGAACCTGGAGGGTGGAGG + Intronic
1042259774 8:66846396-66846418 CGGTTAAACCTGGGAGGCGGAGG - Intronic
1042406927 8:68416613-68416635 CACTCAAACCTGGTAGGAGGAGG - Intronic
1042522999 8:69734113-69734135 CACTTGTGCCTGGCGGGAGGTGG - Intronic
1042525415 8:69759727-69759749 CACTTGAACCTGGCAGGTGGAGG - Intronic
1042890743 8:73607651-73607673 CACTTTAACCTGGGAGGAGGAGG + Intronic
1043503724 8:80881842-80881864 CACTTAAACCTGGGTGGTGGAGG + Intergenic
1043612588 8:82083540-82083562 CACTTGAACCTGGTGGGTGGAGG + Intergenic
1044573271 8:93742735-93742757 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1044868876 8:96599023-96599045 CACTTGAACCTGGGAGGAGGAGG - Intronic
1045122088 8:99048729-99048751 CAGTTGAACCTGGGAGGCGGAGG + Intronic
1045183864 8:99816184-99816206 CACTTGAACCTGGCAGGTGGAGG - Intronic
1045445884 8:102263303-102263325 CACTTAAACCTGGGAGGTGGAGG + Intronic
1045460739 8:102423298-102423320 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1045657183 8:104399205-104399227 CAGTTGAACCTGGGGGGTGGAGG + Intronic
1045885128 8:107086723-107086745 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1046625672 8:116574203-116574225 CACTTAAACCTGGGAGGTGGTGG + Intergenic
1046868375 8:119176387-119176409 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1047036951 8:120950601-120950623 CACTTAAACCCGGGAGGAGGAGG - Intergenic
1047083211 8:121487260-121487282 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1047118843 8:121877314-121877336 CACTTGAACCTGGAAGGAGGAGG - Intergenic
1047241342 8:123092096-123092118 CACTTGAACCTGGAGGGTGGAGG - Intronic
1047379496 8:124345825-124345847 CACTTAAACCTGGGAGGTGGAGG - Intronic
1047737292 8:127777245-127777267 CACTTAAACCCGGTGGGTGGAGG - Intergenic
1047981588 8:130188648-130188670 CATTTAAACCTGGGAGGCGGAGG + Intronic
1048404501 8:134106228-134106250 CAGTGAAATCTGGCCTGAGGTGG + Intergenic
1048813530 8:138309951-138309973 CACTTAAACCTGGGAGGTGGAGG - Intronic
1049764062 8:144344881-144344903 CACTTGAACCTGGGGGGTGGAGG + Intergenic
1049790416 8:144469831-144469853 CAGTGAAGCCTGGGAGGAGGAGG - Intronic
1050158108 9:2689386-2689408 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1050337484 9:4603344-4603366 CACTTGAACCTGGGGGGTGGAGG + Intronic
1050432259 9:5573922-5573944 CACTTGAACCTGGTGGGGGGCGG - Intergenic
1050719020 9:8563743-8563765 CACTTGAACCTGGAGGGTGGAGG - Intronic
1051273903 9:15381062-15381084 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1051635403 9:19176857-19176879 CACTTAAACCCGGGGGGTGGAGG + Intergenic
1051757630 9:20421178-20421200 CACTTAAACCTGGGAGGTGGAGG + Intronic
1051778217 9:20659134-20659156 CACTTAAACCTGGGGGGCGGAGG + Intronic
1051976889 9:22961288-22961310 CACTTAAACCTGGGAGGTGGAGG - Intergenic
1052860102 9:33432701-33432723 CTCTTAAACCTGGGAGGAGGAGG - Intergenic
1053235923 9:36454205-36454227 CATTTGAACCTGGCAGGTGGAGG - Intronic
1053336200 9:37274421-37274443 CACTTAAACCTGGGAGGTGGAGG - Intronic
1053370636 9:37558892-37558914 CAGTTAAACCTGGGAGGTGGAGG - Intronic
1053795328 9:41721609-41721631 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1054149844 9:61593241-61593263 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1054183740 9:61933676-61933698 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1054469611 9:65524341-65524363 CACTTGAACCTGGGGGGTGGAGG - Intergenic
1054654767 9:67654811-67654833 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1055031635 9:71775951-71775973 CACTTGAACCTGGGGGGCGGAGG + Intronic
1055033093 9:71790273-71790295 CACTTAAACCTGGGAGGCGGAGG + Intronic
1055048549 9:71956331-71956353 CAGTTGAACCTGGGAGGTGGAGG - Intronic
1055146127 9:72936986-72937008 CAGTGAAACCTAGGGGAAGGTGG + Intronic
1055510651 9:76992697-76992719 CACTTGAACCTGGCAGGTGGAGG + Intergenic
1055730576 9:79276137-79276159 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1055872956 9:80906779-80906801 CACTTAAACCTGGGGGTCGGAGG - Intergenic
1055975621 9:81951907-81951929 CACTTGAACCTGGCAGGCGGAGG - Intergenic
1056121531 9:83493245-83493267 CAGTAAGACCTGCAGGGAGGTGG + Intronic
1056169001 9:83964591-83964613 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1056437038 9:86584851-86584873 CACTTGAACCTGGGGGGCGGAGG - Intergenic
1056447652 9:86681442-86681464 CAGTTGAACCTGGGAGGCGGAGG + Intergenic
1056538753 9:87553577-87553599 CACTTAAACCTGGGAGGTGGAGG - Intronic
1056661898 9:88549906-88549928 CACTTAAACCTGGGAGGCGGAGG - Intronic
1057043634 9:91866499-91866521 CACTCAAACCTGGCAGGTGGAGG - Intronic
1057110145 9:92462059-92462081 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1057494389 9:95548837-95548859 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1057636792 9:96776699-96776721 CAGTTGAACCTGGGAGGTGGAGG + Intronic
1057886619 9:98834537-98834559 CAGATAAACCTGGTGGTGGGTGG + Intronic
1058042590 9:100319720-100319742 CACTTAAACCTGGGAGGTGGAGG + Intronic
1058679604 9:107429554-107429576 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1058693692 9:107540914-107540936 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1058739026 9:107924080-107924102 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1058863292 9:109138627-109138649 CACTTAAACCTGGGAGGTGGAGG + Intronic
1058863503 9:109140368-109140390 CACTTAAACCTGGGAGGTGGAGG + Intronic
1058868707 9:109184301-109184323 CATTTGAACCTGGGGGGCGGAGG - Intronic
1058877438 9:109256856-109256878 CACTTAAACCTGGGAGGCGGAGG + Intronic
1059202048 9:112427136-112427158 CACTTAAACCTGGGAGGTGGAGG - Intronic
1059949466 9:119447134-119447156 CACTAGAACCTGGGGGGAGGTGG + Intergenic
1060427604 9:123519519-123519541 CACTTGAACCTGGCAGGTGGAGG - Intronic
1060606567 9:124920042-124920064 CGGTTAAACCTGGGAGGTGGAGG - Intronic
1060810233 9:126607694-126607716 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1060840887 9:126792290-126792312 CAGTTGAACCTGGGAGGAGGAGG + Intergenic
1061092618 9:128435075-128435097 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1061307806 9:129742239-129742261 CACTTAAACCTGGGAGGTGGAGG + Intronic
1061451314 9:130668351-130668373 CCGGTAAACCCGGCGGGGGGAGG + Intronic
1061560472 9:131399191-131399213 CACTTAAACCTGGGAGGTGGAGG + Intronic
1061827196 9:133266149-133266171 CACTTAAACCTGGGAGGCGGAGG + Intronic
1062060170 9:134491083-134491105 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1062672343 9:137718837-137718859 CACTTAAACCTGGGAGGCGGGGG - Intronic
1185483229 X:463630-463652 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1185502952 X:612813-612835 CACTTGAACCTGGCAGGTGGAGG - Intergenic
1185551879 X:988603-988625 CAGTTAAACCTGGGAGTTGGAGG - Intergenic
1185561449 X:1063283-1063305 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1185590307 X:1272035-1272057 CAGTTGAACCTGGAAGGTGGAGG - Intronic
1185590989 X:1277013-1277035 CACTTGAACCTGGCAGGTGGAGG + Intronic
1185600392 X:1335193-1335215 CACTTAAACCCGGCAGGCGGAGG - Intergenic
1185711408 X:2306543-2306565 CGCTTGAACCTGGCGGGTGGAGG - Intronic
1186075749 X:5876471-5876493 CACTTAAACCTGGGAGGTGGAGG + Intronic
1186385210 X:9104278-9104300 CAGTTGAACCTGGGAGGCGGAGG - Intronic
1186403177 X:9278236-9278258 CACTTGAACCTGGCAGGCGGAGG + Intergenic
1186919531 X:14262857-14262879 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1187153409 X:16702136-16702158 CACTTGAACCTGGCAGGCGGAGG - Intronic
1187157478 X:16734293-16734315 CACTTAAACCTGGGAGGTGGAGG + Intronic
1187342145 X:18430943-18430965 CACTTGAACCTGGGGGGCGGAGG - Intronic
1187461726 X:19492881-19492903 CACTTGAACCTGGGAGGAGGCGG + Intronic
1188556417 X:31417373-31417395 CACTTGAACCTGGGAGGAGGAGG - Intronic
1188686223 X:33073746-33073768 CACTTGAACCTGGCAGGCGGAGG + Intronic
1188882052 X:35501141-35501163 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1189286737 X:39857135-39857157 CACTGACACCTGGGGGGAGGGGG + Intergenic
1189815239 X:44818196-44818218 CACTTGAACCTGGCAGGTGGAGG - Intergenic
1190201521 X:48365700-48365722 CACTTAAACCTGGGTGGTGGAGG + Intergenic
1190574155 X:51816195-51816217 CACTTGAACCTGGGAGGAGGAGG - Intronic
1190706593 X:53033850-53033872 CACCTAAACCTGGGAGGAGGAGG + Intergenic
1190830804 X:54057485-54057507 CAGTTGAACCTGGGAGGTGGAGG + Intergenic
1190948499 X:55119093-55119115 CATTTAAACCTGGGAGGTGGAGG + Intronic
1192279420 X:69668658-69668680 CATTTAAACCTGGGAGGTGGAGG - Intronic
1192491471 X:71579746-71579768 CAGTTGAAGGTGGCTGGAGGTGG + Intronic
1192609428 X:72553126-72553148 CACTTGAACCTGGGAGGAGGAGG - Intronic
1192659128 X:73023130-73023152 CACTTAAACCTGGGAGGTGGTGG - Intergenic
1192677077 X:73209115-73209137 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1193483520 X:82058139-82058161 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1193667086 X:84334010-84334032 CAGTTAAAGGTAGAGGGAGGTGG - Intronic
1194002491 X:88449267-88449289 CGCTTGAACCTGGCGGGCGGAGG - Intergenic
1194011501 X:88567866-88567888 CAGATATATCTGGGGGGAGGAGG - Intergenic
1194712564 X:97253202-97253224 CACTTGAACCTGGCAGGCGGAGG + Intronic
1195051043 X:101097414-101097436 TAGGTAAACTTGGCGGGGGGCGG - Intergenic
1195076241 X:101329439-101329461 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1195879778 X:109580548-109580570 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1196631855 X:117950381-117950403 CACTTGAACCTGGGGGGCGGAGG + Intronic
1196729088 X:118922927-118922949 CACTTGAACCTGGGAGGAGGAGG + Intergenic
1196785387 X:119417340-119417362 CACTTAAACCTGGGAGGCGGAGG + Intronic
1197763818 X:130046466-130046488 CACTTAAACCTGGGAGGCGGAGG - Intronic
1198116991 X:133554095-133554117 CACTTAAACCTGGGAGGTGGAGG - Intronic
1198192052 X:134316615-134316637 CATTTAAACCTGGGAGGCGGAGG + Intergenic
1198274013 X:135084277-135084299 CACTTTAACCTGGGAGGAGGAGG - Intergenic
1198458855 X:136844476-136844498 CAGTTGAACCTGGGAGGTGGAGG - Intergenic
1198539102 X:137618130-137618152 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1198601764 X:138291753-138291775 CACTTAAACCTGGGAGGCGGAGG - Intergenic
1198754207 X:139965951-139965973 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1198828920 X:140728154-140728176 CACTTAAACCTGGGAGGTGGAGG + Intergenic
1198833709 X:140778519-140778541 CACTTAAACCTGGGAGGCGGAGG + Intergenic
1198977117 X:142348394-142348416 CACTTGAACCTGGGGGGCGGAGG + Intergenic
1199617527 X:149669623-149669645 CAGTTGAACCCGGCGGGGAGCGG + Intergenic
1199625116 X:149733626-149733648 CAGTTGAACCCGGCGGGGAGCGG - Intergenic
1200158254 X:153989810-153989832 CACTTGAACCTGGGAGGAGGAGG - Intergenic
1200244095 X:154513544-154513566 CAGTTGAACCTGGGTGGCGGAGG + Intronic
1200306366 X:155029669-155029691 CACTTGAACCTGGGAGGAGGAGG + Intronic
1201909883 Y:19123211-19123233 CATTTGAACCTGGGAGGAGGTGG + Intergenic