ID: 1108245065

View in Genome Browser
Species Human (GRCh38)
Location 13:48505841-48505863
Sequence TTCGGTTCTCAGCTCTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108245065_1108245071 30 Left 1108245065 13:48505841-48505863 CCTTGGCAGAGCTGAGAACCGAA 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1108245071 13:48505894-48505916 ACCAGCTGCTGCAGAACTGTGGG 0: 1
1: 0
2: 0
3: 37
4: 349
1108245065_1108245070 29 Left 1108245065 13:48505841-48505863 CCTTGGCAGAGCTGAGAACCGAA 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1108245070 13:48505893-48505915 TACCAGCTGCTGCAGAACTGTGG 0: 1
1: 0
2: 0
3: 16
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108245065 Original CRISPR TTCGGTTCTCAGCTCTGCCA AGG (reversed) Intronic
903030721 1:20462422-20462444 CTGGGGTCTCAGCTCTTCCAAGG + Intergenic
906506968 1:46387540-46387562 TTCCTTACTCAGGTCTGCCACGG + Intergenic
906696290 1:47825572-47825594 TTGGATGCTGAGCTCTGCCAGGG + Intronic
907811169 1:57871569-57871591 TTAGGATCCCAGCTTTGCCATGG - Intronic
908355838 1:63324055-63324077 TTCGGCTCACAGCTCGGCCCGGG + Exonic
910327278 1:86025159-86025181 CTCAGTTCTCAGTTCTACCAAGG + Intronic
914891200 1:151625123-151625145 TCAGTTTCTCAGCTTTGCCAGGG + Intronic
915493780 1:156266756-156266778 ATCTGTTCTCAACTCTTCCAAGG + Intronic
915946160 1:160153181-160153203 CTTGGTGCTCAGCTCTTCCAAGG - Exonic
916395326 1:164380658-164380680 TTCAGAGCTCAGCTGTGCCAAGG + Intergenic
917802664 1:178584523-178584545 TTCTAATCCCAGCTCTGCCATGG - Intergenic
918173566 1:182022370-182022392 TTCTTTACCCAGCTCTGCCAGGG - Intergenic
918186189 1:182129683-182129705 TTCTGTGCTTAGCACTGCCAAGG + Intergenic
920943484 1:210506011-210506033 TTCTGGTCTGAGTTCTGCCATGG + Intronic
921582769 1:216914207-216914229 TTCTAATCTCAGCTCTGACACGG + Intronic
922223733 1:223627797-223627819 TTAGCATCTCAGCTCTGCCTCGG - Intronic
923522089 1:234742975-234742997 TTCAAGTCTCAGCTCTTCCAGGG - Intergenic
924262189 1:242243409-242243431 TTCAGTTCTAAGCTCTTCCCAGG - Intronic
1063005035 10:1962011-1962033 TTCTGCTCTCAGCTCTGACATGG - Intergenic
1064370664 10:14749623-14749645 CTCGGTTCCCATCTCTGCGAAGG - Intronic
1064388229 10:14918448-14918470 TCCGGTTCTCACCCATGCCAAGG - Intronic
1064974696 10:21101296-21101318 ATCGATTCTCAGTTCTTCCAAGG + Intronic
1066417319 10:35233297-35233319 AGCAGTTCTCAGCTCTGTCAGGG - Intergenic
1066485371 10:35838011-35838033 TCCATTTCTCAGCACTGCCAAGG - Intergenic
1070428514 10:76313106-76313128 TTTGTGTCCCAGCTCTGCCAAGG + Intronic
1074162469 10:110845849-110845871 CTTTGTTCTCAGCTCTGCCTGGG - Intergenic
1074224137 10:111467224-111467246 TTGGGTTCTCAGCAAAGCCAAGG + Intergenic
1076250022 10:128978194-128978216 CAGGGTTGTCAGCTCTGCCAGGG - Intergenic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1077253023 11:1568942-1568964 ATCGGGGCTCAGCTATGCCAGGG + Intronic
1080331371 11:31143596-31143618 CTCAGTTCTCAGCTCTGCATTGG + Intronic
1080349739 11:31369766-31369788 GTCGCTTCTGAGCTGTGCCACGG + Exonic
1083103385 11:60333864-60333886 TCTGTTTCTGAGCTCTGCCACGG + Intergenic
1083597045 11:63922910-63922932 CTGGGTGCTCTGCTCTGCCAGGG + Intergenic
1083631298 11:64096868-64096890 ATCGGCTCTCAGCTCTGCCGGGG - Intronic
1083870916 11:65488062-65488084 TTCGGTACTCAGCGCAGGCAGGG - Intergenic
1087519962 11:99219462-99219484 TATGGTTCTCAGCTCTGCCTAGG - Intronic
1088646898 11:111924688-111924710 TTTGATTTTCAGCTCTTCCAGGG - Intronic
1094125461 12:27018384-27018406 TTTGCTTCTCAGCTCTCCAATGG - Intergenic
1097750515 12:63347531-63347553 TTCAGCTCTCAGATCTGCAAAGG + Intergenic
1098145760 12:67496474-67496496 TTTGAATCTCAGCTCTGTCATGG - Intergenic
1101212827 12:102551616-102551638 TACAGTCCTCAGCCCTGCCAGGG - Intergenic
1101602600 12:106223698-106223720 TTCACTTTTCATCTCTGCCAAGG + Intergenic
1103670720 12:122612723-122612745 TTTGGTTTTCAGTACTGCCAGGG + Intronic
1104129398 12:125878515-125878537 GTAGGTTAACAGCTCTGCCACGG + Intergenic
1104658107 12:130589181-130589203 TTGGGTTGACAGCCCTGCCAGGG - Intronic
1104877109 12:132043033-132043055 ATCAGTGCTCAGCTCTTCCATGG + Intronic
1108245065 13:48505841-48505863 TTCGGTTCTCAGCTCTGCCAAGG - Intronic
1108478666 13:50844684-50844706 TTCCATCCTCAGGTCTGCCAGGG - Intergenic
1112351015 13:98633177-98633199 TTCCTGTCTCAGCTCTCCCACGG + Intergenic
1113554423 13:111220247-111220269 TTCGTTGCTCACCTTTGCCAAGG + Intronic
1113611289 13:111646423-111646445 TTCAAGTCCCAGCTCTGCCACGG - Intronic
1120860378 14:89249981-89250003 CTCACTTCTCAGCTCTGCCCAGG - Intronic
1121904238 14:97724942-97724964 TTCTGATCTCAGCTCTGTCATGG + Intergenic
1124516046 15:30368122-30368144 TTCGGGCCTCAGCTCTCCAATGG + Intronic
1124635344 15:31361357-31361379 TTGGTTTCTCACCTCTGACAAGG + Intronic
1124726874 15:32162609-32162631 TTCGGGCCTCAGCTCTCCAATGG - Intronic
1125363037 15:38884887-38884909 TACTGTGCTCAGCTCAGCCATGG - Intergenic
1128816829 15:70616134-70616156 TTCTGTGCTCAGCTCTGCAATGG - Intergenic
1129656358 15:77527827-77527849 TTCCAGTCCCAGCTCTGCCATGG - Intergenic
1129677945 15:77642545-77642567 TGGAGTGCTCAGCTCTGCCAAGG + Intronic
1133775141 16:8889751-8889773 TGGAGTTCTCAGCTCAGCCAGGG + Intergenic
1134182810 16:12061406-12061428 TTCTGTTCTCAGCCCTGCCTTGG + Intronic
1137622090 16:49882915-49882937 TTCTGTTTCCAGCCCTGCCATGG - Intergenic
1138227445 16:55309583-55309605 TTTGGTCCTCAGCTCTGGCTTGG - Intergenic
1139251958 16:65505271-65505293 TTGGGCTCTCTGCCCTGCCAGGG + Intergenic
1139877785 16:70160201-70160223 TTCTGTTCTTAGCACTGCCAGGG + Exonic
1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG + Intergenic
1145912153 17:28549023-28549045 TTCTGGCCTCCGCTCTGCCAAGG + Intronic
1147135159 17:38429861-38429883 TGTGGTTCTCCCCTCTGCCAGGG + Intronic
1148673598 17:49431881-49431903 TTCTGTTTTCACCTCTGCCCAGG - Intronic
1154434923 18:14335759-14335781 ACAGGTCCTCAGCTCTGCCACGG + Intergenic
1156901356 18:42303815-42303837 TTCTTTTCTAAGCTCTGTCAAGG - Intergenic
1157330547 18:46700761-46700783 TTTGGTTCTCATCTCTGCCTTGG - Intronic
1159192862 18:65070749-65070771 TTCCTTCCTCAGCACTGCCATGG - Intergenic
1161390957 19:4019878-4019900 CTCGGCTCCCAGCCCTGCCAGGG - Intronic
1162157000 19:8684957-8684979 CTGGGATCTCAACTCTGCCACGG + Intergenic
1162410102 19:10500552-10500574 TGCAGTTGTCAGCTCTGGCAGGG - Intronic
1163432092 19:17274285-17274307 TTCAGATCTCAGATCTGCCAAGG + Intronic
1163688218 19:18724374-18724396 TCAGGTTCTCAGCCCTGCCCTGG + Intronic
1163700082 19:18782536-18782558 TCGGGGTCTCAGCTCTTCCATGG + Intergenic
1167287967 19:48609564-48609586 TTGGGATCTAAGCTCTGCCTCGG - Intronic
1167611124 19:50508139-50508161 TCCTGCTCTCAGCTCTCCCATGG + Intronic
1167705934 19:51081286-51081308 TTCGGTTCTCAGCAGGTCCATGG + Intronic
1167707106 19:51087645-51087667 TTCTGTGCTCAGCACAGCCAGGG + Intergenic
1168432403 19:56291673-56291695 TCCTGTTCTCATCTCTGCCAAGG + Intronic
926944419 2:18171278-18171300 TTCAAATCTCACCTCTGCCATGG + Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930091202 2:47532862-47532884 TTCTGCTCTCAGCTCTCCGAGGG - Intronic
931979597 2:67680232-67680254 TAGGTTTCACAGCTCTGCCATGG - Intergenic
931988689 2:67767345-67767367 TTCCTTTCTCAGCTCTGCAGAGG - Intergenic
936407160 2:112215282-112215304 TTCGCTTCTCAGCTGTGGCTCGG - Exonic
936456604 2:112679729-112679751 GTTGGCTCACAGCTCTGCCAAGG - Intergenic
936677960 2:114737729-114737751 TTCTGTTCTCAGTTCTGTCAAGG + Intronic
937449720 2:121992203-121992225 ATCCGTTCTCCCCTCTGCCATGG - Intergenic
940249671 2:151661102-151661124 TTCTTTTCTCAACTCTGCAATGG + Intronic
943604402 2:189960064-189960086 TTTGGAACTCAGTTCTGCCAAGG - Intronic
945188813 2:207166131-207166153 TTCGGTTCTCCGCGCAGCCGTGG + Intronic
946583688 2:221159853-221159875 TTAGCTTCTCAGTTCTGCAATGG - Intergenic
1169154004 20:3313898-3313920 TCTGGCTCTCAGCTCTGCCTCGG - Intronic
1170314545 20:15028690-15028712 TTCACATCTCAGCTCAGCCATGG - Intronic
1172354284 20:34268922-34268944 TCCGGTCCTCACCTCTGCCTGGG - Intronic
1172633393 20:36393633-36393655 TTTGGTTCTCAGCTCTCTAAAGG - Intronic
1173844335 20:46178504-46178526 TTTTGTCCTCAGCTGTGCCAAGG + Intronic
1175523811 20:59619821-59619843 TTTGCTTCTCAGCTCCGCCAGGG - Intronic
1183633650 22:39047877-39047899 TTTTGTTCTCAGCACTTCCATGG + Intronic
1184273595 22:43398311-43398333 TCCTGGTCCCAGCTCTGCCATGG + Intergenic
1184499162 22:44861552-44861574 TCCAGTTCTCTGCTCTGCCCTGG + Intronic
950045955 3:9948788-9948810 TTCGGTTTACAGCTGGGCCAGGG + Exonic
950584600 3:13883357-13883379 TTCGAAGCTCAGCTCAGCCATGG - Intergenic
952091020 3:29886363-29886385 TTCGATTCCCAGCTCTACCTCGG - Intronic
952943234 3:38459027-38459049 TTTTGCTCTCACCTCTGCCAGGG - Intronic
956267559 3:67414289-67414311 TCCTGTTCTCAAATCTGCCAAGG - Intronic
956446973 3:69335256-69335278 TGCTTTTCTCAGATCTGCCAAGG - Intronic
961773675 3:129268600-129268622 ACCTGTTCTCTGCTCTGCCATGG - Exonic
965054528 3:163696680-163696702 TTCCTTACTCAGCTATGCCACGG + Intergenic
965771182 3:172182486-172182508 TTTGGTTGTCCGCTCTGACAGGG + Intronic
965902130 3:173654972-173654994 TTCAGATCTCAGCTCTTCCATGG + Intronic
968893513 4:3385240-3385262 TTCTGTCCTCCTCTCTGCCAAGG - Intronic
969027521 4:4185619-4185641 TTGGGTTTTGGGCTCTGCCAAGG - Intergenic
969718151 4:8878265-8878287 TTTGGGTCCCAGCTCTGCCATGG + Intergenic
972661719 4:41122889-41122911 TTCTGTCCTCACCTCTGCCCTGG + Intronic
973974669 4:56250652-56250674 TTTGAATCTCAGCACTGCCAGGG + Intronic
975286826 4:72631174-72631196 TCAGGTTCTCTGCTGTGCCAAGG + Intergenic
980249883 4:130301360-130301382 TTTGGTTCACAGGTTTGCCAAGG - Intergenic
992150039 5:73893803-73893825 TGGGGTTTTCAGCTCTCCCAAGG + Intronic
992322337 5:75626084-75626106 TTTGGTTCTGTGGTCTGCCATGG - Intronic
992344761 5:75865535-75865557 TACTGTTCACAGCTCTTCCATGG - Intergenic
994662097 5:102666418-102666440 TTCCGTGCTCAGGACTGCCATGG - Intergenic
997101649 5:130975812-130975834 TTCTTTTCTCAGTTCTCCCAAGG + Intergenic
997508440 5:134436731-134436753 TTGTGCTCTCAGCTCTGCGAAGG - Intergenic
1001428377 5:171640172-171640194 TTTGGATGTCAGCTCTGCCAGGG - Intergenic
1002026652 5:176400486-176400508 TTGGGTCCCCAGCTCTGGCAAGG - Intronic
1003610104 6:7605376-7605398 TTCGGTGCTTACCTCTCCCAAGG + Exonic
1004107738 6:12681548-12681570 TTCTGTTCTCAGGTGTGTCAAGG - Intergenic
1004838321 6:19554189-19554211 TTCAGATCTCAGTTCTGACATGG + Intergenic
1006912967 6:37576026-37576048 TCTGGGTCTCAGCTCTGCAAAGG + Intergenic
1007736877 6:43987453-43987475 TTCTCTTCTCAGCCCTGCCCTGG + Intergenic
1010029060 6:71254127-71254149 TTTGATTCTCAGCTCTGCTGTGG - Intergenic
1010258068 6:73783108-73783130 TTCAGTTAGCAGCACTGCCAGGG - Intronic
1012218842 6:96623273-96623295 TTCAGATCCCAGCTCTGCCACGG + Intergenic
1016444434 6:144118092-144118114 TTCCTTTCTCAGGTATGCCACGG + Intergenic
1019221877 6:170479508-170479530 TTCTGTCCTCAGGTTTGCCATGG - Intergenic
1020015556 7:4829383-4829405 TTCGGAGCTCAGCTCTCCCTGGG + Intronic
1021865570 7:24953274-24953296 ATCATTTGTCAGCTCTGCCAAGG + Intronic
1022330956 7:29378551-29378573 TCAAGTACTCAGCTCTGCCATGG - Intronic
1024786409 7:52912043-52912065 CTCGGGTCTCACGTCTGCCAAGG - Intergenic
1026016045 7:66671456-66671478 TTCGGGGCTCAGCCTTGCCATGG + Intronic
1026024997 7:66737491-66737513 TTCGGGGCTCAGCCTTGCCATGG + Intronic
1026517191 7:71083029-71083051 TTCTGTGCTCAGATCTTCCATGG + Intergenic
1027942714 7:84705220-84705242 TTCAGATCTCAGCCCTGACAGGG - Intergenic
1031570825 7:123357025-123357047 TTTGTTTTTCAGCTCTGCCCTGG - Intergenic
1031906373 7:127464507-127464529 TTTGGGTGTCACCTCTGCCAGGG - Intergenic
1032880686 7:136087042-136087064 TTCTGTTCTCATCTCTGTTATGG + Intergenic
1034269778 7:149797917-149797939 TTGCGTGCTCAGCTCTGCCCTGG + Intergenic
1034348748 7:150403252-150403274 CTCCATTCTCTGCTCTGCCACGG - Intronic
1036954427 8:13171944-13171966 TTCTGAGCTCTGCTCTGCCATGG - Intronic
1037600519 8:20390061-20390083 TTCTTTTCTCAACTCTGCCAGGG - Intergenic
1037683837 8:21120753-21120775 TTTGATTTCCAGCTCTGCCATGG - Intergenic
1041487261 8:58392679-58392701 TTAGCTTCTCTGCTCTGGCAGGG - Intergenic
1042739527 8:72027708-72027730 TTCTGCTCACAGTTCTGCCATGG + Intronic
1043957846 8:86383158-86383180 TTTGATTCTCTGCTATGCCATGG + Intronic
1047649637 8:126905938-126905960 TTCAAGTTTCAGCTCTGCCATGG + Intergenic
1048596833 8:135875411-135875433 TTCAGTTCCTAGGTCTGCCAAGG + Intergenic
1051898102 9:22009327-22009349 TTCCGTTTTCAGCTGGGCCAAGG + Exonic
1053886873 9:42650158-42650180 TCCTGTCCTCAGATCTGCCAGGG - Intergenic
1054225892 9:62457608-62457630 TCCTGTCCTCAGATCTGCCAGGG - Intergenic
1054864521 9:69986505-69986527 TTCAAATCTCAGCTCTGTCATGG + Intergenic
1058190572 9:101910075-101910097 TTCAGTTTTCAGCTTTGTCAAGG - Intergenic
1188217930 X:27501882-27501904 TTCTTTAGTCAGCTCTGCCAAGG - Intergenic
1189269308 X:39739741-39739763 GTAGGATCCCAGCTCTGCCATGG - Intergenic
1190004360 X:46720766-46720788 TTCTTTTCTCTTCTCTGCCACGG - Intronic
1191054257 X:56226126-56226148 TTCTGTTCACAATTCTGCCATGG + Intergenic
1193892421 X:87066560-87066582 TTCTCTTTCCAGCTCTGCCATGG - Intergenic
1198450871 X:136766597-136766619 TTCGTTTCTTAGCTCTGCAGCGG - Intronic
1200059182 X:153476720-153476742 TTGGGCTCCCAGTTCTGCCATGG - Intronic