ID: 1108246032

View in Genome Browser
Species Human (GRCh38)
Location 13:48515196-48515218
Sequence CTAGGTTACCTGTTGTTGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108246032 Original CRISPR CTAGGTTACCTGTTGTTGCA AGG Exonic
900823603 1:4909053-4909075 CTAGTGTATCTGTTGTTTCAAGG - Intergenic
908375105 1:63529122-63529144 CTTACTTACCTGTTGTTGCTAGG + Intronic
912563454 1:110566736-110566758 CTAGGTTACCTGTATTTCCATGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914937833 1:151995322-151995344 CTCGGATCCCTTTTGTTGCAGGG + Intergenic
916196716 1:162230661-162230683 CGTGGTTAACTGGTGTTGCAGGG - Intronic
918463400 1:184798051-184798073 AAAGGTTACCTGGTGCTGCAGGG - Intronic
922876902 1:228947236-228947258 TTAGGCTATCTGTTGTTACAGGG - Intergenic
923417458 1:233777417-233777439 CTAGGATACCTGGTGTTTCTAGG - Intergenic
923872423 1:238010459-238010481 CTTGTTTGCCTGTTGTTGAATGG + Intergenic
924847682 1:247789638-247789660 TTAGCTTACCTGATATTGCAGGG - Intergenic
1065244571 10:23744217-23744239 CTAGGTAGCCTGTTGTCCCAGGG + Intronic
1065702235 10:28436680-28436702 CGAGCTTCCGTGTTGTTGCATGG - Intergenic
1069117309 10:64523655-64523677 CTAGGTGATCTGTTTTTCCAGGG - Intergenic
1073872361 10:107880010-107880032 CTATGTTACCTGGTATTGGAGGG - Intergenic
1093363127 12:18256953-18256975 GTAGGTTACTTGTTGTTGGCAGG + Intronic
1097458258 12:59828382-59828404 CAAGATCACCTGTTTTTGCAAGG - Intergenic
1099083152 12:78211423-78211445 CTATGTTAACTGGTGTTGCTTGG - Exonic
1106448821 13:29861524-29861546 CCAACTTACCTGTTGTTGCTAGG - Intergenic
1108246032 13:48515196-48515218 CTAGGTTACCTGTTGTTGCAAGG + Exonic
1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG + Intergenic
1115670497 14:35606771-35606793 CTTATTTACTTGTTGTTGCAGGG - Intronic
1115894003 14:38063403-38063425 CCAGGTTACTTTTTGTTGTAAGG - Intergenic
1116269611 14:42744698-42744720 TTTGGTTACCTGTGCTTGCAGGG - Intergenic
1123470889 15:20551276-20551298 GTAGTTTCCCTCTTGTTGCAGGG + Intergenic
1123647170 15:22449434-22449456 GTAGTTTCCCTCTTGTTGCAGGG - Intergenic
1123731191 15:23146263-23146285 GTAGTTTCCCTCTTGTTGCAGGG + Intergenic
1123749329 15:23343678-23343700 GTAGTTTCCCTCTTGTTGCAGGG + Intergenic
1124281700 15:28367564-28367586 GTAGTTTCCCTCTTGTTGCAGGG + Intergenic
1124301003 15:28544044-28544066 ATAGTTTCCCTCTTGTTGCAGGG - Intergenic
1124917329 15:33988575-33988597 TAAGGTCACCTGTGGTTGCAGGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141644558 16:85360318-85360340 CCAGGTCAGCCGTTGTTGCAGGG - Intergenic
1143930460 17:10417914-10417936 CTGAGTTTCCTGTTGTTCCATGG - Intronic
1146356700 17:32140601-32140623 CTTGGTTACCTGATCTTTCAGGG - Intergenic
1147017929 17:37507345-37507367 CTAGGGTACTTGGTGCTGCAGGG - Intronic
1148845384 17:50527013-50527035 CTGGGTTACCTGTTTTTGTCTGG + Intronic
1153915629 18:9741882-9741904 CCAGGTTTCCTGGTGTGGCAGGG + Intronic
1158326174 18:56315892-56315914 CTGTGTCACCTGTTTTTGCATGG + Intergenic
1159536232 18:69718404-69718426 CAATGTTACTTCTTGTTGCATGG - Intronic
1163765852 19:19162862-19162884 CTCGGTTTCCTGTGTTTGCAGGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1166355832 19:42226709-42226731 GAAGGTTACCTGATGTTGCTGGG - Exonic
925133871 2:1512960-1512982 CAAGCCTAACTGTTGTTGCACGG + Intronic
933185409 2:79272904-79272926 CTAGGTTATGTTTTGTTGCAAGG + Intronic
941303482 2:163831217-163831239 CTAAGGTACCTGCTTTTGCATGG - Intergenic
946822252 2:223642339-223642361 CTAGGTTTCCTGTTGTCACTTGG - Intergenic
1168950757 20:1799976-1799998 GTAGTTTCCCTCTTGTTGCAAGG - Intergenic
1179995055 21:44970429-44970451 CTGGGTTACCTGTTGGTGCTCGG - Intronic
1184938946 22:47746808-47746830 CTGGGTTTTCTGTTGTTGGAGGG + Intergenic
1184946142 22:47805482-47805504 TTAGGTGACTGGTTGTTGCATGG + Intergenic
949290025 3:2454089-2454111 CTAACTTGCCTGTTGTTACATGG + Intronic
949290046 3:2454362-2454384 CTAACTTGCCTGTTGTTACATGG + Intronic
949290067 3:2454635-2454657 CTAACTTGCCTGTTGTTACATGG + Intronic
950981498 3:17311746-17311768 CTACGTTACTTGTTCTTGTAAGG - Intronic
953355774 3:42255112-42255134 CTATGCCACCTGCTGTTGCAGGG - Intergenic
955006079 3:54970188-54970210 CTATTTCACCGGTTGTTGCAAGG - Intronic
956138639 3:66123846-66123868 TTAGGTCACCTTTTGTTACAGGG + Intergenic
962160237 3:132991434-132991456 TTAGTTTACCTATTGTTACATGG - Intergenic
966738284 3:183207786-183207808 CTAGGCAAGCTGTTGCTGCACGG - Exonic
967797456 3:193612992-193613014 CCAGGTCACCTGGTGTTCCAGGG + Intronic
976695155 4:87911084-87911106 CTAGATTGTCTGCTGTTGCAGGG - Intergenic
977688777 4:99879255-99879277 CTAGATTAACTGTTTTTGAAAGG - Exonic
984068337 4:175078903-175078925 ATTGGTTGCCTGTTCTTGCAAGG + Intergenic
984598772 4:181702994-181703016 CTACCTTATCTATTGTTGCAAGG - Intergenic
985768400 5:1794145-1794167 CTTGGTTACCATTTGTTGCAGGG + Intergenic
987099602 5:14580803-14580825 TTAAGTTAACTGTTGTTGCTGGG + Intergenic
996032688 5:118723489-118723511 CTAGGTTATCTCTGGTTGCAGGG - Intergenic
999921475 5:156326200-156326222 TGAGGTTTCCTCTTGTTGCATGG + Intronic
1006445851 6:34079382-34079404 CTGGCTAAACTGTTGTTGCAGGG - Intronic
1013072315 6:106740524-106740546 CTGGGTTTCCTGCTGTTGCCTGG + Intergenic
1017239715 6:152153945-152153967 CCTGGTTACCTGATGTTGCAAGG + Intronic
1019103060 6:169647639-169647661 CTTGGTTACTTGAAGTTGCATGG - Intronic
1021472259 7:21017660-21017682 CTTGGTTATCTTTTGTTTCATGG + Intergenic
1024872311 7:53979615-53979637 CTAGGTAACCTTTTGATGAAAGG - Intergenic
1027994035 7:85400621-85400643 CCACGTTACCTGTTATTGGAAGG + Intergenic
1031018096 7:116597301-116597323 CAACCTTACCTGTTGTTGTAAGG - Intergenic
1043716020 8:83487893-83487915 CTAGGTTACCTGAGGTTGGGGGG + Intergenic
1043785906 8:84399772-84399794 GTAGTTTACCTGTTGTTAGAAGG + Intronic
1051316642 9:15842082-15842104 CTAGGTTACATTTCCTTGCAGGG - Intronic
1052349020 9:27439150-27439172 CTAGGTTTCCTGAGGTTACAGGG + Intronic
1056235218 9:84587686-84587708 CTAGGTCAGCTGTTTTTACAGGG + Intergenic
1061641961 9:131965710-131965732 CTGGGATACCTTATGTTGCAAGG + Intronic
1187722081 X:22161634-22161656 CTATGTTACCTGTGGTAACATGG + Intronic
1189352440 X:40286149-40286171 CTTGGTTACCTATTATTGCATGG - Intergenic
1191645140 X:63471952-63471974 CCAGGTCACTTGTTGTGGCAAGG - Intergenic
1193563132 X:83044505-83044527 TTAGGTTTCCTGTTCTTGCAGGG + Intergenic
1196485324 X:116199989-116200011 CTTGATTACCTGTGCTTGCAGGG + Intergenic
1198637833 X:138718936-138718958 CTACCTTACATGTTGTTGTAAGG - Intronic