ID: 1108246231

View in Genome Browser
Species Human (GRCh38)
Location 13:48517083-48517105
Sequence TTGTGCTCTCCTAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108246231 Original CRISPR TTGTGCTCTCCTAAGGTGGA AGG (reversed) Intronic
900349126 1:2226842-2226864 CTGTGCTCGCCTGAGGCGGAGGG - Intergenic
902174149 1:14636822-14636844 TTCTCCCCTCCTAAGGAGGATGG - Intronic
907783037 1:57584666-57584688 TTATGCTCTCCTAAGGAACAAGG + Intronic
908598994 1:65718879-65718901 TTCTGCTCTTCTCAAGTGGAAGG + Intergenic
909694535 1:78451472-78451494 CTGTGCCCTCATATGGTGGAAGG - Intronic
910093612 1:83494684-83494706 TTGTGTCCTCCTATGGTGGAAGG + Intergenic
911228533 1:95334434-95334456 CTGTGTTCTCATATGGTGGAAGG + Intergenic
911330730 1:96522980-96523002 TTGGGCTCTTCTAGTGTGGAGGG + Intergenic
911496450 1:98637560-98637582 TTCTCCTCTCCTCAAGTGGAAGG - Intergenic
915591778 1:156874964-156874986 TTGTGCTCAACAAATGTGGACGG + Exonic
917256181 1:173118798-173118820 TTGTGCTCTGATGAGGTGCAGGG - Intergenic
917432975 1:174989977-174989999 ATGTGCTCTCCTTGGGTGGCTGG - Intronic
919008407 1:191928937-191928959 TTTTCCTCTCCTCAAGTGGAAGG - Intergenic
921013104 1:211162035-211162057 TTGGGCTTTCCAAAGCTGGAAGG + Intergenic
922403305 1:225284079-225284101 TGGTATTTTCCTAAGGTGGAAGG - Intronic
924286868 1:242496278-242496300 TTTTGCTCTCCTAAGATGGAAGG + Intronic
924798935 1:247313077-247313099 TTGTGTTCTCACATGGTGGAAGG + Intronic
1064624046 10:17244084-17244106 TTTAGCTCTGCCAAGGTGGAAGG - Intergenic
1065431498 10:25661669-25661691 TTGTCCTCTCTTCAAGTGGAAGG + Intergenic
1065461083 10:25965440-25965462 TTCTCCTCTCCTCAGGGGGAAGG + Intronic
1065941287 10:30566212-30566234 TTGTGGTTGCCTAAGGTTGAGGG - Intergenic
1065997512 10:31072751-31072773 TTGCACTCTCCTAAGCTGGAAGG - Intergenic
1067262028 10:44701129-44701151 TTCTGCTCTCATCAGGTAGAGGG + Intergenic
1070579840 10:77711026-77711048 TTCTGCTCTGCTAAGGTGCCTGG + Intergenic
1071209102 10:83317405-83317427 CTCTGCTCTCCTCAAGTGGAAGG - Intergenic
1075326865 10:121540108-121540130 TTGTACTCTGTTAAGGAGGAAGG - Intronic
1075689618 10:124386536-124386558 GTGTGCTCTCCTGGGGTGGGAGG - Intergenic
1079542183 11:21589685-21589707 TTGTGTTCTCATTTGGTGGAAGG - Intergenic
1080213733 11:29817487-29817509 TTCTCCTCTCCTCAAGTGGAAGG + Intergenic
1081033245 11:38112696-38112718 TTGTCCTCTCTTAAGTAGGAAGG - Intergenic
1085562728 11:77487045-77487067 CTCTCCTCTCCTCAGGTGGAAGG - Intergenic
1085980472 11:81718275-81718297 CTCTCCTCTCCTCAGGTGGAAGG - Intergenic
1086326935 11:85711405-85711427 TTGACCTCACCTAAGGAGGAAGG + Intronic
1087011362 11:93517013-93517035 TTGTCCTCTACTCAGCTGGAAGG + Intronic
1087532986 11:99407456-99407478 GTCTCCTCTCCTAAAGTGGAAGG + Intronic
1090136419 11:124204029-124204051 ATTTCCTCTCCTCAGGTGGAAGG + Intergenic
1091090997 11:132771205-132771227 TTGTTCTCTTCTGAGGTGGATGG - Intronic
1091400490 12:177867-177889 TCCTGCTCTCCTAAGGTTGCGGG + Exonic
1091593206 12:1857633-1857655 TTGTGGTCTCCTAAGGTGATTGG + Intronic
1092146767 12:6220031-6220053 TTGTGCTCTGCTGAGATGGGAGG + Intronic
1092497582 12:9012217-9012239 ATCTCCTCTCCTCAGGTGGAAGG - Intergenic
1092670820 12:10858733-10858755 TTCTCCTCTCCTCATGTGGAAGG - Intronic
1095712257 12:45302891-45302913 TTCTGCACTCCTAAAGTGGTAGG - Intronic
1096325902 12:50661658-50661680 TTGTGCTGTACTAATGTGGAAGG - Intronic
1097533604 12:60837404-60837426 TTGTGTTCTCACATGGTGGAAGG - Intergenic
1098214643 12:68202700-68202722 TTGTGATCCCCAAATGTGGAGGG - Intronic
1098296656 12:69010901-69010923 ATGTGCTCTGTTAAGATGGATGG + Intergenic
1102317886 12:111904721-111904743 CTCTCCTCTCCTCAGGTGGAGGG - Intergenic
1105027888 12:132861668-132861690 TGGTTCTCTCCTGAGCTGGATGG - Intronic
1106738913 13:32618028-32618050 CTGTGTTCTCATATGGTGGAAGG + Intronic
1107349168 13:39496257-39496279 TTGTGTTCTCCCATGGTGGAAGG + Intronic
1107869916 13:44736865-44736887 TTGTGCCCTCACATGGTGGAAGG + Intergenic
1108090840 13:46848043-46848065 TTGGGCTTTCCTGAGCTGGATGG - Intronic
1108246231 13:48517083-48517105 TTGTGCTCTCCTAAGGTGGAAGG - Intronic
1108409813 13:50134299-50134321 TTGTGCTCTGCTAGGGAGGTGGG + Intronic
1108520868 13:51246070-51246092 TTGTGTTTTCCTAAGGAGAAGGG - Intronic
1109381856 13:61572521-61572543 TTTTGGTATCTTAAGGTGGATGG - Intergenic
1110172922 13:72524001-72524023 TTTTACCCTCCTAAGTTGGACGG + Intergenic
1110295440 13:73859029-73859051 TTTTGCTCTCATTAGGTGGTGGG + Intronic
1110836879 13:80093607-80093629 TTTGGCTGTCCTATGGTGGAGGG + Intergenic
1111390791 13:87592049-87592071 CTCTGCTCTCCTCAAGTGGAAGG - Intergenic
1116510611 14:45741975-45741997 ATGTGCTCTCCAAAGGAGGAAGG + Intergenic
1117144921 14:52827745-52827767 TTGTGGCCTCATATGGTGGAAGG - Intergenic
1117365002 14:55017993-55018015 TTGTGCGCTGCTGAGGTGGGAGG - Intronic
1121307288 14:92915011-92915033 CAGTGATCTCCTGAGGTGGAAGG + Intergenic
1121818068 14:96943504-96943526 TTCTGGTCTCCTAAGGAGAAAGG - Intergenic
1122807315 14:104266367-104266389 TCGTGCTCCCCTAGGGTGGAAGG - Intergenic
1123180872 14:106469033-106469055 TTGTGCTCCCTGCAGGTGGAGGG - Intergenic
1202946024 14_KI270726v1_random:27625-27647 TTGTGCTCCCTGCAGGTGGAGGG + Intergenic
1125260912 15:37823773-37823795 CTGTGCTCTCCCAAGGTGGAAGG - Intergenic
1126295035 15:47130106-47130128 CTCTGCTCTCCTCAAGTGGAAGG + Intergenic
1127155819 15:56123468-56123490 TTCTCCTCTCCTCAAGTGGAAGG + Intronic
1127177161 15:56371861-56371883 TTCTGCTCACCTAAGGTTGTGGG + Intronic
1127395584 15:58541770-58541792 CTGTCCCCTCCTCAGGTGGACGG + Exonic
1130386846 15:83419481-83419503 TGGTGCCCTCATAAGGAGGAAGG + Intergenic
1132715958 16:1289909-1289931 TTGTGCTCACCCAAGGGAGAGGG + Intergenic
1133436231 16:5782335-5782357 TTGTGTCCTCCTATGATGGAGGG + Intergenic
1135590591 16:23702264-23702286 TCGTGGTGTCCTAAGGTGGGGGG + Exonic
1137848390 16:51713998-51714020 ATGTGCACTTTTAAGGTGGAAGG + Intergenic
1143069813 17:4281925-4281947 ATTTCCTCTTCTAAGGTGGATGG + Intronic
1146890044 17:36501006-36501028 GTGTGCTCTCCTCAGCAGGAGGG - Intronic
1147500274 17:40956417-40956439 TTTTGCTCTCCATAGGAGGAAGG + Intergenic
1151542301 17:74770800-74770822 GAGTGCTCCCCTCAGGTGGAAGG + Exonic
1157244527 18:46041578-46041600 CTGTGCTCTCCAAGGTTGGAGGG + Intronic
1158429840 18:57375447-57375469 CTGTGCTTTCCCATGGTGGAAGG - Intergenic
1160728415 19:629172-629194 TTCTGGTTTCCTGAGGTGGAAGG - Intronic
1165521333 19:36316652-36316674 CTGTGCCGTCCTATGGTGGAAGG + Intergenic
1165622728 19:37261936-37261958 CTGTGCCGTCCTATGGTGGAAGG - Intergenic
1168058369 19:53876440-53876462 TTGTGCTTTCTTAATGAGGAGGG + Intergenic
924981437 2:225781-225803 TTTTGATCTGCTAAGGTGAATGG - Intronic
925868404 2:8248386-8248408 CTGTGCTGTCCTATGGAGGAAGG - Intergenic
926041745 2:9679223-9679245 TTGTGTTCTCACATGGTGGAAGG - Intergenic
926719274 2:15947151-15947173 TTGTCCCCACTTAAGGTGGAGGG + Intergenic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
928935828 2:36677057-36677079 AGGTGCACTCCTAAGGCGGAAGG - Intergenic
929182298 2:39054735-39054757 GTTTGTTCTCCTGAGGTGGAAGG + Exonic
929942263 2:46343253-46343275 AGGTGTTCTCCTAAGGTGAATGG + Intronic
930683669 2:54285101-54285123 CTGTGCCCTCATATGGTGGAAGG + Intronic
932639762 2:73432594-73432616 CTGTGCCCTCCCATGGTGGAAGG + Intronic
934706442 2:96484859-96484881 TTGAGTTATCCCAAGGTGGAAGG - Intergenic
935966479 2:108481941-108481963 TTCTTCTCTCCTAAGTGGGAAGG - Intronic
939710343 2:145509472-145509494 CTCTGCTCTCCTCAAGTGGAAGG + Intergenic
939720349 2:145642569-145642591 TTGTTCAGTTCTAAGGTGGATGG + Intergenic
940672982 2:156693637-156693659 CTGTGCTCTCACATGGTGGAGGG - Intergenic
942750124 2:179277367-179277389 TACTCCTCTCCAAAGGTGGAGGG - Intergenic
944085298 2:195839438-195839460 CTCTGGTTTCCTAAGGTGGAAGG - Intronic
944919494 2:204396703-204396725 TTGTGTTCTCACATGGTGGAAGG + Intergenic
946824987 2:223668578-223668600 TTTTGCTACCCTGAGGTGGACGG + Intergenic
946984642 2:225257981-225258003 CTCTCCTCTCCTCAGGTGGAAGG - Intergenic
947086976 2:226464580-226464602 GTGTGCTCTCCTCTGCTGGAGGG - Intergenic
1169409920 20:5359632-5359654 TGGTGTTCTCATATGGTGGAAGG + Intergenic
1182077332 22:27504107-27504129 CTGTGCTCTCCTACTGTGGTTGG - Intergenic
953206706 3:40837682-40837704 CTGTGTTCTCATATGGTGGAAGG + Intergenic
953242336 3:41160663-41160685 TTGTGTTCTCACATGGTGGAAGG - Intergenic
954966833 3:54619308-54619330 ATGTGCACTGCTTAGGTGGAGGG + Intronic
955389255 3:58508273-58508295 GTGTGCTCTCCTAGGATGGCTGG + Intronic
960677924 3:120214866-120214888 CTCTGCAATCCTAAGGTGGATGG + Intronic
961792746 3:129388048-129388070 CTGTGCCCTCCTAAAGTGTAGGG + Intergenic
962875670 3:139534404-139534426 GTGTTCTCTCCCCAGGTGGAGGG - Intronic
962990179 3:140570834-140570856 TTGCTTTCTCCTGAGGTGGAAGG - Exonic
964340864 3:155707078-155707100 CTGTGTTCTCATATGGTGGAAGG - Intronic
964349755 3:155791065-155791087 TTTTCCTCTCCTCAGGTAGAAGG - Intronic
967648507 3:191956132-191956154 TTGTGCTCAACTAAGGAGCACGG + Intergenic
967697027 3:192543914-192543936 CTATCCTCTCCTAAGGTGGAGGG + Intronic
968314559 3:197712426-197712448 TTGTGCCCTCGTCAGGAGGAGGG - Intronic
970096684 4:12471591-12471613 TTGTGTTCTCATATGGTGAAGGG + Intergenic
970901610 4:21165944-21165966 CTGTGTCCTCCCAAGGTGGAAGG - Intronic
971906491 4:32732678-32732700 TTTTGCTGTCCTTTGGTGGAGGG - Intergenic
977102991 4:92842326-92842348 TTGTTCTCTCCTATAGTAGATGG - Intronic
977748969 4:100585412-100585434 TTGTGTTCTCACATGGTGGAAGG - Intronic
978661988 4:111137796-111137818 TTCTCCTCTCCTCAAGTGGAAGG + Intergenic
979565126 4:122146062-122146084 CTGTCCTCTCCTCAAGTGGAAGG + Intergenic
980660862 4:135855879-135855901 CTGTCCTCTCCTCAGGTGTAAGG + Intergenic
985820299 5:2155583-2155605 ATGTGCTCATTTAAGGTGGAAGG - Intergenic
986057587 5:4154027-4154049 CTGTGTTCTCCTGTGGTGGAAGG - Intergenic
986673908 5:10167393-10167415 TTGTGCCCTCACATGGTGGAAGG + Intergenic
987197115 5:15537627-15537649 TTGTGGTCCCCGAAGGGGGAGGG + Intronic
987537344 5:19206358-19206380 TTCTTCTCTCCTCAGGTGGAGGG - Intergenic
987738076 5:21870458-21870480 CTGTGCTATCCTATGGTGGAAGG - Intronic
989436631 5:41421017-41421039 TTTTACTCTCCTAAGGTAAAGGG + Intronic
990827874 5:59922448-59922470 CTCTCCTCTCCTTAGGTGGAGGG - Intronic
993222624 5:85120591-85120613 TTGTGCTCTCATATAGTGGAAGG - Intergenic
993260247 5:85648049-85648071 TTGTGACCTTCTAAGGTGCATGG + Intergenic
993997406 5:94739238-94739260 TTTTGTTCTTCAAAGGTGGAAGG - Intronic
994994393 5:107041393-107041415 GTGTGTTCTCATAAGGTAGATGG - Intergenic
995494892 5:112731407-112731429 TTGTGTCATCCCAAGGTGGAAGG + Intronic
999421963 5:151452207-151452229 TTCTGCTCTGGTAAGTTGGATGG + Intronic
1003780225 6:9416056-9416078 TGGTGCTCTCCAGAGGTGGGAGG + Intergenic
1003846898 6:10183105-10183127 TTGTGCCCTCACATGGTGGAAGG - Intronic
1004574702 6:16884273-16884295 TTCTACTGTCTTAAGGTGGAAGG + Intergenic
1006108105 6:31728738-31728760 TTCTCCTATCCTAAGGTCGATGG - Exonic
1008177674 6:48288511-48288533 CTCTCCTCTCCTAAAGTGGAAGG + Intergenic
1008636019 6:53411943-53411965 TTGTGTCATCCTATGGTGGAAGG + Intergenic
1011709811 6:90041581-90041603 TTGTGTTCTTCTATGGTGGTTGG + Intronic
1012351664 6:98259235-98259257 GGGTGTTCTTCTAAGGTGGAAGG - Intergenic
1014282409 6:119456366-119456388 TTGTGCTCTCCTGAGGGACACGG + Intergenic
1016537091 6:145119629-145119651 TAGTGGTCTCCTTTGGTGGAGGG - Intergenic
1017681480 6:156868565-156868587 CTGTGTCCTCCTATGGTGGAAGG + Intronic
1019130020 6:169866500-169866522 TTGTGATCTTCTAGGATGGATGG + Intergenic
1022741194 7:33123146-33123168 CTCTCCTCTCCTAAAGTGGAAGG + Intergenic
1023570708 7:41568504-41568526 TTGTACCCTCATATGGTGGAGGG - Intergenic
1026683696 7:72490133-72490155 TTGAACTCTACTAATGTGGAAGG - Intergenic
1028181429 7:87729821-87729843 CTCTCCTCTCCTTAGGTGGAGGG - Intronic
1028284662 7:88981400-88981422 CTCTCCTCTCCTCAGGTGGAAGG + Intronic
1028908684 7:96183389-96183411 TAGTACTCTGCTGAGGTGGACGG - Intronic
1030225834 7:107149493-107149515 TTGTGTTCTCACATGGTGGAAGG + Intronic
1031375946 7:121026045-121026067 TAGTGATCTCCTAACGGGGACGG - Intronic
1031377697 7:121048411-121048433 TTGTCATCTCCTAAGATAGAAGG + Intronic
1031409072 7:121420861-121420883 TAGTGCTCTCCTCAGGTGCCTGG + Intergenic
1034996829 7:155582618-155582640 ATGTGCTCTCACATGGTGGAAGG - Intergenic
1035084590 7:156247315-156247337 TTCTCCTCTCCTTAGGGGGAGGG + Intergenic
1035763599 8:2087522-2087544 GTGGGGTCTCCTAGGGTGGAAGG + Intronic
1038283105 8:26183231-26183253 TTGTGCTCTCACATAGTGGATGG - Intergenic
1039075573 8:33688049-33688071 TTGTGCCCTCATATGGTGCAAGG + Intergenic
1041135328 8:54751947-54751969 GTGGGCTCTTCTAAGGTTGAAGG + Intergenic
1042043028 8:64615048-64615070 TTGTTCTCTGGTGAGGTGGATGG + Exonic
1043340316 8:79229899-79229921 CTTTGCTCTCCTCAAGTGGAAGG + Intergenic
1046419770 8:113965000-113965022 TTGTGTTCTCTTATGGTGGCAGG - Intergenic
1047597448 8:126393272-126393294 CTGTGTTCTCATAATGTGGAAGG - Intergenic
1048901288 8:139040137-139040159 ATATGCTCTCCCCAGGTGGATGG - Intergenic
1050186232 9:2977322-2977344 TTGTGTTCTCACATGGTGGAAGG - Intergenic
1051663488 9:19446527-19446549 TGCTTCTCTCCTCAGGTGGACGG + Intronic
1061979917 9:134096244-134096266 TTGTGCTCTCACATGGTGAAAGG - Intergenic
1062066505 9:134530486-134530508 TTGGGGTCTCATAAGGTTGAAGG + Intergenic
1062073571 9:134572325-134572347 TTGTGCCCTGCTAGTGTGGATGG + Intergenic
1185513568 X:681035-681057 CTGTGCTCTCATGTGGTGGAAGG + Intergenic
1186932776 X:14412961-14412983 CTCTTCTCTCCTCAGGTGGAAGG - Intergenic
1187372827 X:18724883-18724905 TAGTGCTGTCCTGTGGTGGATGG + Intronic
1187646094 X:21348668-21348690 TTGTACTCTTCAAAGCTGGATGG - Intergenic
1188108319 X:26168214-26168236 TTCTCCTCTCCTCAAGTGGAGGG + Intergenic
1188110121 X:26187311-26187333 TTGTACTTTTCTAAGGTGGAAGG - Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1190537823 X:51447017-51447039 CTCTCCTCTCCTCAGGTGGAAGG + Intergenic
1191060613 X:56291877-56291899 TTGTGTTTTCCTAAGATGTAAGG + Intergenic
1191078866 X:56487624-56487646 TTGTATTCTCCAAAGCTGGAAGG + Intergenic
1192037249 X:67577136-67577158 TTGTGCTTGCCTAGGGTTGAAGG - Intronic
1192548620 X:72035330-72035352 TTCTGCTCTCGTTGGGTGGAGGG + Intergenic
1192968591 X:76206647-76206669 TTCTCCTCTCCTCAAGTGGAAGG + Intergenic
1193803241 X:85962826-85962848 TTGTACGCTTCTAAGATGGAGGG + Intronic
1194046830 X:89017708-89017730 TTGTGTTCTCACATGGTGGAAGG - Intergenic
1194361079 X:92950905-92950927 CTCTCCTCTCCTCAGGTGGAAGG + Intergenic
1194561508 X:95427692-95427714 TTCTTCTCTCCTCAAGTGGAAGG - Intergenic
1194990607 X:100543230-100543252 CTCTCCTCTCCTCAGGTGGAGGG - Intergenic
1197075690 X:122350253-122350275 GTCTCCTCTCCTAAAGTGGAAGG - Intergenic
1198882365 X:141295188-141295210 CTTTGCTCTCCTCAAGTGGAAGG - Intergenic
1198995285 X:142567138-142567160 CTCTTCTCTCCTCAGGTGGAAGG + Intergenic
1200669273 Y:6066714-6066736 CTCTCCTCTCCTCAGGTGGAAGG + Intergenic