ID: 1108246653

View in Genome Browser
Species Human (GRCh38)
Location 13:48522155-48522177
Sequence AACTACTGGATGGCCTCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108246649_1108246653 1 Left 1108246649 13:48522131-48522153 CCAAAAATGTTTTAACTGTTCTG 0: 1
1: 0
2: 0
3: 30
4: 404
Right 1108246653 13:48522155-48522177 AACTACTGGATGGCCTCTTACGG 0: 1
1: 0
2: 1
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108246653 Original CRISPR AACTACTGGATGGCCTCTTA CGG Intronic
910133092 1:83932868-83932890 AACTGCTGGATGGGATCTTCTGG + Intronic
910369591 1:86502296-86502318 ATCCACTAGATGGCCTCTTGAGG - Intergenic
910370282 1:86508174-86508196 ATCCACTAGATGGCCTCTTGAGG - Intergenic
918195407 1:182216845-182216867 AGCTACTGCTTTGCCTCTTATGG + Intergenic
922958218 1:229623448-229623470 AACTACTGGAGGGCCCCTGAGGG - Intronic
923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG + Intronic
1065356273 10:24845129-24845151 AACTGCTCGATGGCCTCATGTGG - Intergenic
1066298431 10:34076031-34076053 AACTACAGGAGGGCCGCTGATGG - Intergenic
1075173297 10:120135875-120135897 AACCAGTGCATGGCCTATTATGG + Intergenic
1079708362 11:23650595-23650617 AGCTATTGGATGTCCTCTTTCGG + Intergenic
1081490323 11:43563176-43563198 AACTTCTGTATGGCCCATTATGG + Intronic
1085246656 11:75107438-75107460 CTGGACTGGATGGCCTCTTACGG - Intronic
1089071849 11:115706620-115706642 AGTTACTGGTTGGCCTGTTAGGG - Intergenic
1089754377 11:120675602-120675624 AGCAACTGGATGGCATCATAGGG + Intronic
1090846112 11:130531298-130531320 AACCACAGGATGGCCTCTCTGGG - Intergenic
1092570575 12:9716835-9716857 AACTACTGAATGGATTATTATGG + Intronic
1095418377 12:41999921-41999943 AACTCCAGGATGGCCTCGAAGGG - Intergenic
1107452280 13:40520666-40520688 AACAACTGCATGGACTGTTAAGG - Intergenic
1108246653 13:48522155-48522177 AACTACTGGATGGCCTCTTACGG + Intronic
1112416096 13:99204713-99204735 AACTACTGGATGAGCTTTTCTGG - Intronic
1113265082 13:108607881-108607903 AACTACTGGTTGTTCTCTTAGGG + Intronic
1114260677 14:21034035-21034057 AACTTCTGGATGGCCTTCCAAGG + Exonic
1119081622 14:71699833-71699855 AAGAACTGGATGGCCTCATGAGG + Intronic
1119167408 14:72506456-72506478 TACCACTGAATGGTCTCTTATGG - Intronic
1125782297 15:42280538-42280560 GACTCCTGGAAGGCCTCTGATGG - Intronic
1126545885 15:49873761-49873783 AAGTACTGCATGGCCTCAGAAGG - Intronic
1127070566 15:55284701-55284723 AACTTCTTCATGACCTCTTAAGG + Intronic
1138604217 16:58077488-58077510 AACTAATGGATGGAGACTTAGGG + Intergenic
1139430979 16:66910906-66910928 AGCCACTGGAGGGCCTCTCAGGG - Intronic
1141248863 16:82336735-82336757 GACAACTGGATGGCCTCATCTGG + Intergenic
1141478826 16:84292692-84292714 AACTACTGGCTGAGCCCTTATGG - Intergenic
1147306991 17:39570895-39570917 GACTACTGGATGGTCTCTAAGGG + Intergenic
1158502681 18:58017831-58017853 CAGTACTTGATAGCCTCTTAAGG - Intergenic
1160569172 18:79804712-79804734 AACAAGTGGAGGGCCTCTTCAGG + Intergenic
1165590049 19:36960933-36960955 GCCTACTCGATGGCCTATTATGG + Intronic
926031982 2:9599408-9599430 AAGTACTTGATGGCATCTTCTGG - Intronic
939124941 2:138166045-138166067 AAATGCTGGATGGCATCTTTTGG - Intergenic
945986085 2:216354717-216354739 ATCAACTTGATGACCTCTTAAGG - Intronic
949811536 3:8012038-8012060 AACAACTGGATGGCCTCACCTGG + Intergenic
953958070 3:47246769-47246791 AACTAAGGGATGGACTCTTCTGG - Intronic
967591969 3:191287894-191287916 AATTACTGGATGGAATCTTTAGG - Intronic
972140148 4:35948623-35948645 AACTACTGGAAGGCATCTAGAGG + Intronic
974154089 4:58047845-58047867 AACCACTTGATGCCTTCTTATGG + Intergenic
976610622 4:87026540-87026562 AGCAACTGGATGGCCACTCAAGG - Intronic
982975509 4:162053275-162053297 AACCACAGTATGTCCTCTTAAGG + Intronic
983454422 4:167944954-167944976 AATTTCTGGGTGGCCTGTTATGG - Intergenic
986333677 5:6736843-6736865 ACCTCCTTGTTGGCCTCTTAAGG + Intronic
992579444 5:78156987-78157009 GACTACAGGTGGGCCTCTTAGGG - Intronic
994279582 5:97885715-97885737 AACTACTGGATCAACTCTGATGG - Intergenic
1005491575 6:26352291-26352313 AACAGCTGGAAGGCCTCTTTGGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1010085892 6:71917696-71917718 AACTACTGAATGGTCTCTTAAGG - Intronic
1015394097 6:132716049-132716071 AACTGCTTGCTGACCTCTTAGGG + Intergenic
1018269951 6:162066319-162066341 AAATAAAGGATGGCCTTTTAAGG - Intronic
1022051690 7:26680707-26680729 AAGTACTGGCTTGCCTTTTAAGG + Intronic
1023325432 7:39050559-39050581 AACTTCTGGTTGGCCCATTAGGG + Intronic
1030673447 7:112362175-112362197 CACTTCTGCATGGCCTCTTTGGG + Intergenic
1030876653 7:114821313-114821335 CAATACTGCATGGTCTCTTACGG + Intergenic
1039969620 8:42310177-42310199 AACTAGTGTGTGGCCTCTCAAGG - Intronic
1045368246 8:101495210-101495232 AACTACAGGCAGGCCTCGTAAGG - Intronic
1049268009 8:141679810-141679832 AACAACCAGATGGCCTCATAGGG - Intergenic
1060770652 9:126329511-126329533 CACTGCTGGATGCCCTCTCAGGG + Intronic
1185998070 X:4975565-4975587 AACAACTGGATGGACCCTGAGGG - Intergenic
1193356748 X:80528054-80528076 AACTTGTAGATGGCCTCTTGTGG + Intergenic
1195771412 X:108355324-108355346 AACTACTGGATGGTATATTTTGG - Intronic
1199443360 X:147894400-147894422 AACTTCTAGTTGACCTCTTATGG - Intergenic
1202179672 Y:22128826-22128848 CACTACTGGATAGCCTTTTCTGG - Intergenic
1202211689 Y:22457568-22457590 CACTACTGGATAGCCTTTTCTGG + Intergenic