ID: 1108248497

View in Genome Browser
Species Human (GRCh38)
Location 13:48541590-48541612
Sequence GGAAGGACACAATACCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108248497_1108248505 22 Left 1108248497 13:48541590-48541612 CCTAGATGGTATTGTGTCCTTCC No data
Right 1108248505 13:48541635-48541657 GTTGTTTCTTTCTGTGATATTGG No data
1108248497_1108248503 0 Left 1108248497 13:48541590-48541612 CCTAGATGGTATTGTGTCCTTCC No data
Right 1108248503 13:48541613-48541635 ACCAGGAGGCATTTAATGTTGGG No data
1108248497_1108248502 -1 Left 1108248497 13:48541590-48541612 CCTAGATGGTATTGTGTCCTTCC No data
Right 1108248502 13:48541612-48541634 CACCAGGAGGCATTTAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108248497 Original CRISPR GGAAGGACACAATACCATCT AGG (reversed) Intergenic
No off target data available for this crispr