ID: 1108249906

View in Genome Browser
Species Human (GRCh38)
Location 13:48553965-48553987
Sequence TCATTTCCCCACTTAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108249906_1108249909 30 Left 1108249906 13:48553965-48553987 CCTGGTTCTAAGTGGGGAAATGA No data
Right 1108249909 13:48554018-48554040 TTTTTTCTTTTTTGAGATGGAGG No data
1108249906_1108249908 27 Left 1108249906 13:48553965-48553987 CCTGGTTCTAAGTGGGGAAATGA No data
Right 1108249908 13:48554015-48554037 TTCTTTTTTCTTTTTTGAGATGG 0: 159
1: 4389
2: 93170
3: 75807
4: 90875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108249906 Original CRISPR TCATTTCCCCACTTAGAACC AGG (reversed) Intergenic
No off target data available for this crispr