ID: 1108252885

View in Genome Browser
Species Human (GRCh38)
Location 13:48584297-48584319
Sequence TAGTTGGGAGTTGTATACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108252885_1108252890 26 Left 1108252885 13:48584297-48584319 CCAAAGTATACAACTCCCAACTA No data
Right 1108252890 13:48584346-48584368 GGTTATGTACCGTCACTTAATGG No data
1108252885_1108252892 28 Left 1108252885 13:48584297-48584319 CCAAAGTATACAACTCCCAACTA No data
Right 1108252892 13:48584348-48584370 TTATGTACCGTCACTTAATGGGG No data
1108252885_1108252889 5 Left 1108252885 13:48584297-48584319 CCAAAGTATACAACTCCCAACTA No data
Right 1108252889 13:48584325-48584347 GTAGCTTTGATTTAAATGATGGG No data
1108252885_1108252891 27 Left 1108252885 13:48584297-48584319 CCAAAGTATACAACTCCCAACTA No data
Right 1108252891 13:48584347-48584369 GTTATGTACCGTCACTTAATGGG No data
1108252885_1108252888 4 Left 1108252885 13:48584297-48584319 CCAAAGTATACAACTCCCAACTA No data
Right 1108252888 13:48584324-48584346 TGTAGCTTTGATTTAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108252885 Original CRISPR TAGTTGGGAGTTGTATACTT TGG (reversed) Intergenic
No off target data available for this crispr