ID: 1108252886

View in Genome Browser
Species Human (GRCh38)
Location 13:48584312-48584334
Sequence TCAAAGCTACACATTTAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108252886_1108252890 11 Left 1108252886 13:48584312-48584334 CCCAACTAAATGTGTAGCTTTGA No data
Right 1108252890 13:48584346-48584368 GGTTATGTACCGTCACTTAATGG No data
1108252886_1108252893 18 Left 1108252886 13:48584312-48584334 CCCAACTAAATGTGTAGCTTTGA No data
Right 1108252893 13:48584353-48584375 TACCGTCACTTAATGGGGACAGG No data
1108252886_1108252889 -10 Left 1108252886 13:48584312-48584334 CCCAACTAAATGTGTAGCTTTGA No data
Right 1108252889 13:48584325-48584347 GTAGCTTTGATTTAAATGATGGG No data
1108252886_1108252891 12 Left 1108252886 13:48584312-48584334 CCCAACTAAATGTGTAGCTTTGA No data
Right 1108252891 13:48584347-48584369 GTTATGTACCGTCACTTAATGGG No data
1108252886_1108252892 13 Left 1108252886 13:48584312-48584334 CCCAACTAAATGTGTAGCTTTGA No data
Right 1108252892 13:48584348-48584370 TTATGTACCGTCACTTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108252886 Original CRISPR TCAAAGCTACACATTTAGTT GGG (reversed) Intergenic
No off target data available for this crispr