ID: 1108252890

View in Genome Browser
Species Human (GRCh38)
Location 13:48584346-48584368
Sequence GGTTATGTACCGTCACTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108252885_1108252890 26 Left 1108252885 13:48584297-48584319 CCAAAGTATACAACTCCCAACTA No data
Right 1108252890 13:48584346-48584368 GGTTATGTACCGTCACTTAATGG No data
1108252887_1108252890 10 Left 1108252887 13:48584313-48584335 CCAACTAAATGTGTAGCTTTGAT No data
Right 1108252890 13:48584346-48584368 GGTTATGTACCGTCACTTAATGG No data
1108252886_1108252890 11 Left 1108252886 13:48584312-48584334 CCCAACTAAATGTGTAGCTTTGA No data
Right 1108252890 13:48584346-48584368 GGTTATGTACCGTCACTTAATGG No data
1108252884_1108252890 29 Left 1108252884 13:48584294-48584316 CCTCCAAAGTATACAACTCCCAA No data
Right 1108252890 13:48584346-48584368 GGTTATGTACCGTCACTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108252890 Original CRISPR GGTTATGTACCGTCACTTAA TGG Intergenic
No off target data available for this crispr