ID: 1108252892

View in Genome Browser
Species Human (GRCh38)
Location 13:48584348-48584370
Sequence TTATGTACCGTCACTTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108252887_1108252892 12 Left 1108252887 13:48584313-48584335 CCAACTAAATGTGTAGCTTTGAT No data
Right 1108252892 13:48584348-48584370 TTATGTACCGTCACTTAATGGGG No data
1108252886_1108252892 13 Left 1108252886 13:48584312-48584334 CCCAACTAAATGTGTAGCTTTGA No data
Right 1108252892 13:48584348-48584370 TTATGTACCGTCACTTAATGGGG No data
1108252885_1108252892 28 Left 1108252885 13:48584297-48584319 CCAAAGTATACAACTCCCAACTA No data
Right 1108252892 13:48584348-48584370 TTATGTACCGTCACTTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108252892 Original CRISPR TTATGTACCGTCACTTAATG GGG Intergenic
No off target data available for this crispr