ID: 1108266417

View in Genome Browser
Species Human (GRCh38)
Location 13:48713341-48713363
Sequence TGTGAGCTGAAACACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 3, 2: 12, 3: 112, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108266417_1108266419 -4 Left 1108266417 13:48713341-48713363 CCAGCACAGTGTTTCAGCTCACA 0: 1
1: 3
2: 12
3: 112
4: 392
Right 1108266419 13:48713360-48713382 CACAGTTTATATATGGACTATGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108266417 Original CRISPR TGTGAGCTGAAACACTGTGC TGG (reversed) Intergenic
902344067 1:15803010-15803032 TGTGACCTAAAACATTGTTCTGG - Intergenic
903783179 1:25835805-25835827 TATGAGATGAAACACTCTTCTGG + Exonic
904081212 1:27873553-27873575 TGGGACCTCAAACACTCTGCTGG - Intronic
904363584 1:29995476-29995498 TCAGAGCTCAAACGCTGTGCTGG - Intergenic
907289367 1:53403004-53403026 AATGAGCTGTAACACTCTGCTGG + Intergenic
907978829 1:59460557-59460579 TCAGAGCTCAAACACTGTGCTGG - Intronic
908813501 1:68008580-68008602 TCTGAGCTCAAACACCATGCTGG + Intergenic
908821627 1:68093088-68093110 TCAGAGATCAAACACTGTGCTGG + Intergenic
909301176 1:74014993-74015015 TCAGAGCTCGAACACTGTGCTGG - Intergenic
909403353 1:75258654-75258676 TTGGAGCTCAAACGCTGTGCTGG - Intronic
909557474 1:76969681-76969703 TCTGAGCTCAAACACCATGCTGG - Intronic
909608585 1:77531205-77531227 TATGAGCTGTAACACTGCGAAGG - Intronic
909807881 1:79894085-79894107 TCAGAGCTCAAACACTGGGCTGG + Intergenic
911339230 1:96617347-96617369 TCTGAGCTCAAACACTGTGCTGG + Intergenic
911990698 1:104693512-104693534 TCAGAGCTCAAACACTGTGTTGG - Intergenic
912529847 1:110312431-110312453 TGTTACTTGAAACACTTTGCTGG + Intergenic
912636232 1:111296215-111296237 TCAGTGCTCAAACACTGTGCTGG - Intronic
914884518 1:151574253-151574275 TGTGACCTAAAACACGGAGCAGG - Exonic
915045538 1:153011270-153011292 TATGAGCTGTAACACTGCGGGGG - Intergenic
916038350 1:160941388-160941410 TCAGAGCTCAAACACTGTGCTGG + Intergenic
916708232 1:167376113-167376135 TGTGAGATGATAAACTGCGCTGG - Exonic
917111731 1:171555909-171555931 TCAGAGCTCAAACACCGTGCTGG + Intronic
917764112 1:178198806-178198828 CCAGAGCTCAAACACTGTGCTGG + Intronic
917903961 1:179571558-179571580 TCAGAGCTCAAACGCTGTGCTGG + Intronic
918684463 1:187397444-187397466 TCAGAGCTCAAACACTGTGCTGG - Intergenic
918890306 1:190257973-190257995 TCTGAGCTCAAACACCATGCTGG + Intronic
918968188 1:191378297-191378319 TCAGAGCTCAAACACTGTGCTGG + Intergenic
919356036 1:196523068-196523090 TTTGAGCTGTAACACTGCGAAGG + Intronic
920588850 1:207196589-207196611 TCTGAGCTCAAACACCGTGCTGG - Intergenic
920878315 1:209858046-209858068 TGTGAGCTGTAACACCGCGAAGG - Intergenic
921004164 1:211076238-211076260 TCAGAGGTCAAACACTGTGCTGG - Intronic
921924724 1:220702053-220702075 AATGGGCTGAAACACTGTGCTGG - Intergenic
922111048 1:222555966-222555988 AGTGAGCTGAAATACTGTGCTGG - Intergenic
922352462 1:224745443-224745465 TTTGAACAGAAACACTGTGGTGG - Intergenic
923853488 1:237821153-237821175 TTAGAGCTCGAACACTGTGCTGG - Intronic
924940380 1:248809216-248809238 TCTGAGATGACACACAGTGCTGG - Intergenic
1063846373 10:10132216-10132238 AGAGAGTTTAAACACTGTGCAGG + Intergenic
1064492842 10:15878008-15878030 TCAGAGCTCAAACACGGTGCTGG + Intergenic
1065231013 10:23598599-23598621 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1065353282 10:24814716-24814738 TGTGAGCTAAAACACTGGTTGGG + Intergenic
1066297584 10:34068128-34068150 TCGGAGCTCAAACGCTGTGCTGG - Intergenic
1067127576 10:43532972-43532994 TCAGAACTCAAACACTGTGCTGG + Intergenic
1067332213 10:45333136-45333158 AGTCTGCTCAAACACTGTGCTGG + Intergenic
1068609493 10:59043348-59043370 TCCGAGCTCAAACACCGTGCTGG + Intergenic
1068651643 10:59528845-59528867 TCAGAGCTCAAACGCTGTGCTGG - Intergenic
1069300372 10:66900003-66900025 TCAGAGCTCAAACACTGTGCTGG - Intronic
1071698450 10:87903338-87903360 TCAGAGCTCAAACACTGTGCTGG + Intronic
1071838610 10:89445235-89445257 TCAGAGCTCAAACACTGTGATGG - Intronic
1072370146 10:94757915-94757937 TCAGAGCTCAAACACTGTGCTGG + Intronic
1072477576 10:95777643-95777665 TCTGAGCTCAAACACCATGCTGG + Intronic
1073304619 10:102493191-102493213 AGTGAGCTGAAAGACTGGGAAGG + Intronic
1073927402 10:108533094-108533116 TTAGAGCTCAAACACCGTGCTGG - Intergenic
1073940695 10:108694390-108694412 TCAGAGCTCAAACACTGTTCTGG - Intergenic
1074016700 10:109542083-109542105 GCAGAGCTCAAACACTGTGCTGG + Intergenic
1074222143 10:111448491-111448513 GCTGAGCTGAAACTCTTTGCAGG + Intergenic
1074668444 10:115758641-115758663 TCAGAGCTCAAACACTGTGCTGG + Intronic
1077655637 11:4016539-4016561 TCGGAGCTCAAACGCTGTGCTGG + Intronic
1078416933 11:11173607-11173629 TTTGACCTAAGACACTGTGCTGG + Intergenic
1078981207 11:16536957-16536979 TCAGAGCTCAAACGCTGTGCTGG - Intronic
1079653959 11:22965399-22965421 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1079849994 11:25520556-25520578 TGTTAGCTGAAACTTTGTGCTGG + Intergenic
1079867962 11:25758924-25758946 GTAGAGCTCAAACACTGTGCTGG - Intergenic
1079998559 11:27321769-27321791 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1081143784 11:39536293-39536315 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
1081241379 11:40710687-40710709 TCAGAGCTCAAACACTCTGCTGG + Intronic
1081958891 11:47118947-47118969 TCAGAGCTCAAACGCTGTGCTGG + Intronic
1082614246 11:55338984-55339006 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1083501699 11:63115053-63115075 TCAGAGCTCATACACTGTGCTGG + Intronic
1084387140 11:68850859-68850881 TGTGACCTGAAACACCGTGGCGG + Intergenic
1085800750 11:79586718-79586740 TCAGAGCTCAAACACCGTGCTGG - Intergenic
1085959974 11:81450279-81450301 TTCTAGCTGAAACACTGTGTTGG - Intergenic
1085986664 11:81795935-81795957 TGTGGGCTGCAAGGCTGTGCTGG - Intergenic
1087410622 11:97786085-97786107 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1087653995 11:100901401-100901423 TCAGAGCTCAAACGCTGTGCTGG + Intronic
1087703728 11:101466219-101466241 GCAGAGCTCAAACACTGTGCTGG + Intronic
1087712274 11:101567493-101567515 TCAGAGCTCGAACACTGTGCTGG - Intronic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1088211875 11:107465963-107465985 GCAGAGCTCAAACACTGTGCTGG + Intergenic
1088213127 11:107478396-107478418 TGTGAGCTGAGGCACTTTGAAGG - Intergenic
1088852188 11:113714153-113714175 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1091002794 11:131924529-131924551 TGTGAGCCGAAGCTCTGTGTAGG + Intronic
1091867298 12:3851765-3851787 TTGGAGCTCAAACACTGTGCTGG - Intronic
1092439142 12:8482503-8482525 TCAGAGCTCAAGCACTGTGCTGG + Intergenic
1092661886 12:10747723-10747745 TCAGAGCTCAAACACTGTGTAGG + Intergenic
1093509460 12:19909141-19909163 TGAGAGCTGAAATGCTGTCCAGG + Intergenic
1093524625 12:20092445-20092467 TATGAGCTGTAACACTGCGAAGG - Intergenic
1094722195 12:33076356-33076378 TATGAGCTGTAACACTCTCCAGG + Intergenic
1094755464 12:33463345-33463367 TCAGAGCTCAAACACTGTGCGGG - Intergenic
1094851665 12:34385031-34385053 TGTAGGCTGAGACACTCTGCGGG + Intergenic
1095356479 12:41280841-41280863 TCAGAGCTGGAACGCTGTGCTGG - Intronic
1095694916 12:45133130-45133152 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1095698386 12:45165607-45165629 ACTGAGCAGCAACACTGTGCAGG - Intergenic
1095720249 12:45392503-45392525 TCAGAGCTCAAACGCTGTGCTGG - Intronic
1095920576 12:47526082-47526104 TCAGAGCTCAAGCACTGTGCTGG + Intergenic
1096950136 12:55459940-55459962 TCAGAGCTCAAACACCGTGCTGG - Intergenic
1097139513 12:56888511-56888533 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1097298122 12:57989236-57989258 TGTGAGGAGAATGACTGTGCAGG + Intergenic
1098052990 12:66473455-66473477 GCAGAGCTGAAGCACTGTGCTGG - Intronic
1098175990 12:67792119-67792141 TTGGAGCTCGAACACTGTGCTGG + Intergenic
1099086944 12:78257624-78257646 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1099428242 12:82550698-82550720 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1099490024 12:83276747-83276769 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1099522570 12:83682169-83682191 TCAGAGCTCGAACACTGTGCTGG - Intergenic
1099697426 12:86040244-86040266 TCAGAGCTCAAACACTGTGCTGG + Intronic
1100211660 12:92405132-92405154 TGTGTGCTGACACATTGTGTGGG - Intergenic
1100233794 12:92637009-92637031 TGTAGGCTGAAATACTGTTCAGG + Intergenic
1100748679 12:97673205-97673227 CCAGAGCTCAAACACTGTGCTGG - Intergenic
1101301673 12:103489441-103489463 TCAGAGCTCAAACACCGTGCTGG + Intronic
1101382010 12:104221764-104221786 TGTTAGATGAAAAACTGAGCTGG + Intronic
1102904153 12:116661615-116661637 TGTGAGCTGTAACACCGTGAAGG + Intergenic
1103145939 12:118596055-118596077 TGTGAGTTGGAACTCAGTGCAGG + Intergenic
1104033558 12:125082455-125082477 TGTGAGCTGTAACACCTGGCTGG + Intronic
1104086315 12:125477745-125477767 TCAGAGCTCAAACACAGTGCTGG - Intronic
1104161930 12:126189713-126189735 TTTGAGTGGATACACTGTGCCGG + Intergenic
1104175340 12:126326145-126326167 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1104841135 12:131826520-131826542 AGTGAGCTGAAGCCCTGGGCTGG - Intergenic
1105676919 13:22681462-22681484 TAAGAGCTGTAACACTGGGCTGG + Intergenic
1106326283 13:28693571-28693593 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1106960079 13:34988283-34988305 TCTGAGCTCAAACACCATGCTGG + Intronic
1108266417 13:48713341-48713363 TGTGAGCTGAAACACTGTGCTGG - Intergenic
1108266977 13:48720658-48720680 TGTGAGCTAAAACACTGTTCTGG - Intergenic
1108362183 13:49677920-49677942 TGTGAGCTGTAACACTGCGAAGG - Intronic
1108918887 13:55652944-55652966 TTTGAGCTGTAACACTGTGAAGG + Intergenic
1109465790 13:62729708-62729730 TCTGAGCTCAAACACCATGCTGG + Intergenic
1109509005 13:63344132-63344154 TGTGACCCAAAGCACTGTGCAGG - Intergenic
1109845586 13:67986079-67986101 AGTGGGGTGAAATACTGTGCTGG + Intergenic
1111006833 13:82259267-82259289 TATGAGCTGTAACACTGGGAAGG + Intergenic
1111524502 13:89451331-89451353 TGTGAGCTCAAACACTTTGTTGG + Intergenic
1113480067 13:110614260-110614282 TAAGAGCTGTAACACTGTGAAGG + Intergenic
1113947075 13:114050354-114050376 TTTGAGCGGGAACACTGTGCTGG - Intronic
1114573200 14:23690039-23690061 TCAGAGCTCAAACACAGTGCTGG + Intergenic
1114981326 14:28168613-28168635 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1115277002 14:31620794-31620816 TCAGAGCTCGAACACTGTGCTGG + Intronic
1115421211 14:33198142-33198164 TATGAGCTGTAACACTGCGAAGG - Intronic
1115533110 14:34345225-34345247 TGTGAGCTGTAACACCGCGAAGG - Intronic
1115743241 14:36410019-36410041 TCAGAGCTGAAATGCTGTGCTGG - Intergenic
1116684388 14:48019081-48019103 TGAGATCTCAAACTCTGTGCTGG - Intergenic
1117005644 14:51418666-51418688 TCTGAGCTCAAACACTGTGCTGG + Intergenic
1117796998 14:59405227-59405249 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1118498506 14:66333366-66333388 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1120280404 14:82431410-82431432 TGTGAGCTCAAACCCCTTGCAGG + Intergenic
1120439967 14:84523782-84523804 TGAGAGCTGCAACAAAGTGCTGG - Intergenic
1120559605 14:85974546-85974568 TCAGTGCTCAAACACTGTGCTGG + Intergenic
1122443313 14:101749714-101749736 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1122966372 14:105129166-105129188 AGTGAGCTGAAACACTGTGTTGG + Intergenic
1123220544 14:106851472-106851494 TGTGACCTCAAACCCTGGGCAGG + Intergenic
1124380226 15:29159331-29159353 TATGAGCTGTAACACCGTGAAGG - Intronic
1124885743 15:33684140-33684162 TCAGAGCTCAAACACTGTGCTGG - Intronic
1124918082 15:33996335-33996357 TCAGAACTCAAACACTGTGCTGG - Intronic
1125345694 15:38716424-38716446 TAAGAGCTGTAACACTGTGAAGG + Intergenic
1125354629 15:38803765-38803787 GGTGAGCTGAAACAGGGTGGGGG - Intergenic
1125779460 15:42251736-42251758 TCAGAGCTCAAACACTGTGCTGG + Intronic
1126041522 15:44595637-44595659 TGTGACCTGCAACACTCTGCAGG - Intronic
1126074472 15:44896024-44896046 TCAGAGCTCGAACACTGTGCTGG + Intergenic
1126087016 15:45020588-45020610 TCAGAGCTCAAACACTGTACTGG + Intergenic
1126996430 15:54450251-54450273 TCAGATCTCAAACACTGTGCTGG + Intronic
1127193763 15:56562043-56562065 TCAGAGCTAAATCACTGTGCTGG - Intergenic
1127524989 15:59784173-59784195 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1127661981 15:61108361-61108383 TGTTAGCAGTAACATTGTGCAGG - Intronic
1128339799 15:66813493-66813515 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1128696623 15:69769648-69769670 TTAGAGCTCAAACACCGTGCTGG - Intergenic
1128782248 15:70368343-70368365 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1129198554 15:73985201-73985223 TGTGGGCTGAACATCTGTGCAGG + Intronic
1130165851 15:81457297-81457319 TGTGAGCTGTAACACCGTGAAGG + Intergenic
1130697780 15:86147761-86147783 TCAGAGCTCAAACACTGTGCTGG - Intronic
1130703637 15:86211327-86211349 TCAGAGCTCAAACACTGTTCTGG + Intronic
1130800885 15:87262190-87262212 TCAGAGCTCAAACACAGTGCTGG + Intergenic
1131719152 15:95148353-95148375 TAGGAGCTGTAACACTGTGAGGG - Intergenic
1132159646 15:99527180-99527202 TATAAGCTCAAACACTTTGCTGG + Intergenic
1132287905 15:100679075-100679097 TCAGAGCTCAAACCCTGTGCTGG + Intergenic
1134335637 16:13297131-13297153 AGTGTGCTGAAACATTATGCAGG - Intergenic
1134459778 16:14421190-14421212 TGTGAGCAGACACGATGTGCAGG - Intergenic
1136274200 16:29168704-29168726 TGTGTGCTGGAACCATGTGCTGG + Intergenic
1137890924 16:52161266-52161288 TCAGAGCTTAAACGCTGTGCTGG + Intergenic
1138549793 16:57741113-57741135 TCTGAGCCGAAGCCCTGTGCAGG + Intronic
1138782870 16:59809947-59809969 TCAGAGCTCAGACACTGTGCTGG - Intergenic
1138892887 16:61166322-61166344 CCAGAGCTGAAACACTGTGCTGG - Intergenic
1139166883 16:64576808-64576830 TGGGAGAGGAAACACTGTGTTGG - Intergenic
1141102062 16:81204760-81204782 TGTGAGCTGAAACACTGTTTTGG + Intergenic
1142078476 16:88134351-88134373 TGTGTGCTGGAACCATGTGCTGG + Intergenic
1142220475 16:88852013-88852035 TCAGAGCTCAAACACTGTGCCGG - Intronic
1145738370 17:27249838-27249860 TCAGAGGTCAAACACTGTGCTGG - Intergenic
1146600903 17:34215231-34215253 TGAGATCTCAAACTCTGTGCTGG + Intergenic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1148950363 17:51305574-51305596 TCAGAGCTCAAACACCGTGCTGG - Intergenic
1149055352 17:52356740-52356762 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1149093812 17:52816914-52816936 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1150181900 17:63131195-63131217 TGTGAACTTAAAAACTGTGGTGG - Intronic
1150391451 17:64791928-64791950 TGTGGGCTCCAACACTGAGCAGG - Intergenic
1150410266 17:64936059-64936081 TGTGGGCTCCAACACTGAGCAGG - Intergenic
1150545837 17:66156011-66156033 GCAGAGCTCAAACACTGTGCTGG - Intronic
1151036548 17:70807031-70807053 TGTGATTTTAAACACTGTGTGGG - Intergenic
1153743223 18:8151142-8151164 TCAGAGCTTCAACACTGTGCTGG + Intronic
1154157046 18:11951874-11951896 TGGGAGCTGGACCTCTGTGCAGG - Intergenic
1155311508 18:24528922-24528944 TGTCAGCTGAGTTACTGTGCGGG + Intergenic
1155499338 18:26471375-26471397 TGTGGGCTGAAATCCTGTGTGGG + Intronic
1155562443 18:27093235-27093257 TCAGAGCTCAAACACTGTGCTGG + Intronic
1155665132 18:28299037-28299059 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1156118590 18:33816815-33816837 TTTGGGCAGAAACACTATGCAGG - Intergenic
1156166689 18:34429519-34429541 TCAGAACTCAAACACTGTGCTGG + Intergenic
1157036783 18:43984615-43984637 TCAGAGCTCAAACACAGTGCTGG - Intergenic
1157656874 18:49399184-49399206 TGTGAGCTCACACACAGGGCTGG - Intronic
1157787904 18:50502573-50502595 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1158145678 18:54309569-54309591 TCAGAGCTCAAACACCGTGCTGG + Intronic
1158597272 18:58827461-58827483 TGTGAACTGTAACACTGTGAAGG - Intergenic
1159905983 18:74092895-74092917 TGTCAGCTGAGACACAGGGCTGG + Intronic
1163940044 19:20483077-20483099 TCCAAGCTCAAACACTGTGCTGG - Intergenic
1163975970 19:20852682-20852704 TGAGATCTCAAACACTGTGCTGG - Intronic
1165853091 19:38862468-38862490 TGTGGTCTGTAACACTGGGCGGG - Intergenic
1167781089 19:51599386-51599408 TATGAGCTGTAACACTGCGAAGG + Intergenic
1167809744 19:51818745-51818767 TCTCACCTGACACACTGTGCTGG - Intronic
1167815010 19:51872437-51872459 TTAGGGCTGAAACACTGTGGAGG - Exonic
925752765 2:7104693-7104715 TGAGAGCTCAAGCACTGTGCTGG + Intergenic
927027978 2:19089891-19089913 TCAGAGCTCAAACGCTGTGCTGG - Intergenic
927117221 2:19916855-19916877 TCAGAGCTTGAACACTGTGCTGG - Intronic
929890704 2:45916939-45916961 TATGAGCTGTAACACTGGGAAGG - Intronic
930216956 2:48707406-48707428 TCAGAGCTTGAACACTGTGCTGG + Intronic
930516072 2:52409682-52409704 TCAGAGCTCAAACACTATGCTGG + Intergenic
931594549 2:63927161-63927183 TCAGAGCTCGAACACTGTGCTGG - Intronic
932565105 2:72901245-72901267 TGTGAGCAAAAGCACTGAGCGGG + Intergenic
933281151 2:80333979-80334001 TTTGACGTGCAACACTGTGCAGG - Intronic
933717026 2:85369133-85369155 TGGGAGCTGAAGCAATCTGCTGG + Intronic
934133626 2:88972719-88972741 TCTGAGCTATAACACTGTGAGGG + Intergenic
934531637 2:95093362-95093384 TCAGAGCTCAAACACTGTGCTGG - Intronic
935062636 2:99621781-99621803 TGGGGCCTGAAACACTGAGCAGG + Intronic
935565987 2:104607969-104607991 TCAGAGTTCAAACACTGTGCTGG - Intergenic
935604693 2:104959104-104959126 TGCAAGCTCAAACACTGTGCTGG + Intergenic
935616896 2:105095291-105095313 TGGGAGCTTAAACACTTTCCTGG + Intronic
936344655 2:111666078-111666100 AGTGTGATGAAGCACTGTGCAGG + Intergenic
936820000 2:116509051-116509073 TCTGAGCTCAAACAATCTGCTGG + Intergenic
936857891 2:116982166-116982188 TCAGAGCTCAAACATTGTGCTGG - Intergenic
936909917 2:117579865-117579887 TCAGAGCTCAAACACTGTGCTGG - Intergenic
937568886 2:123333133-123333155 GGTGAGCAGCAACAGTGTGCAGG + Intergenic
938156816 2:128948773-128948795 TGAGATCTCAAACTCTGTGCTGG + Intergenic
939012533 2:136863333-136863355 TTTGAGATGAAATACAGTGCTGG + Intronic
939019906 2:136946472-136946494 TCCGAGCTCAAACACTGTGCTGG + Intronic
939974824 2:148705483-148705505 TCAGAGCTCAAACACCGTGCTGG - Intronic
940891585 2:159041272-159041294 TCAGAGCTCAAACACTGTACTGG + Intronic
941540544 2:166777921-166777943 TTTTTGCTGAAACAGTGTGCTGG + Intergenic
941675540 2:168339978-168340000 TGTGTGGTGAAATACAGTGCTGG + Intergenic
941845349 2:170126532-170126554 TTAGAGCTCGAACACTGTGCTGG - Intergenic
941896130 2:170630554-170630576 TCAGAGCTCAAACACTGTGCTGG - Intronic
942732649 2:179076532-179076554 GCAGAGCTCAAACACTGTGCTGG - Intergenic
943084942 2:183300315-183300337 TCAGAGCTCAAACAATGTGCTGG + Intergenic
943710832 2:191093201-191093223 TCAGAGCTCAAACACTGTGCTGG - Intronic
944374802 2:199029093-199029115 TCAGAGCTCAAACACTGTGCTGG - Intergenic
944857231 2:203779689-203779711 TAAGAGCTGTAACACTGTGAAGG - Intergenic
945788791 2:214277797-214277819 TCAGAGCTCAAACGCTGTGCTGG + Intronic
946630008 2:221656784-221656806 TTTAAGCTGAGACACTGTCCTGG - Intergenic
946787088 2:223258908-223258930 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
948614127 2:239187454-239187476 GGTGAGCTGAAGCCCTGGGCAGG + Intronic
1168995577 20:2130492-2130514 TTAGAGCTGAAAACCTGTGCGGG + Intronic
1169307054 20:4501323-4501345 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1169728805 20:8764701-8764723 TGTGAGTTGTACCACTGAGCTGG - Intronic
1171081874 20:22194755-22194777 TCAGTGCTCAAACACTGTGCTGG - Intergenic
1171247150 20:23620821-23620843 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1171513342 20:25706215-25706237 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1174753828 20:53138732-53138754 TCTGAGCTGCTACACTCTGCTGG + Intronic
1174894033 20:54429659-54429681 GGTGAGCTGAAAGTCTGAGCGGG - Intergenic
1174990089 20:55500070-55500092 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1176665028 21:9678479-9678501 TATGAGCTGTAACACTGTGAAGG - Intergenic
1176928489 21:14779524-14779546 TCAGAGCTCAAACACCGTGCTGG - Intergenic
1177205345 21:18003788-18003810 AGTGAGCTGAAGCCCTGTGCTGG - Intronic
1177527184 21:22309594-22309616 TGTGAGCTAAAACATGATGCTGG - Intergenic
1179943254 21:44653411-44653433 TGTGAGCTGAAACACGGAGCCGG + Intronic
1180640956 22:17299121-17299143 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1181906918 22:26205397-26205419 TGTGAGCTGAAACACAAAGGAGG - Intronic
1182057805 22:27373679-27373701 TCTGAGCTCAAACGCCGTGCTGG - Intergenic
1185351240 22:50340623-50340645 TGTGAGTTGAAACAGTGACCAGG + Intergenic
949155069 3:817125-817147 GCAGAGCTGAAACTCTGTGCTGG - Intergenic
949683352 3:6541000-6541022 TCCGAGCTTGAACACTGTGCTGG + Intergenic
951434202 3:22643115-22643137 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
951617780 3:24567360-24567382 TCAGAGCTCAAACACCGTGCTGG - Intergenic
951929002 3:27942617-27942639 AGTGATCAGAAACAATGTGCAGG - Intergenic
952632177 3:35482603-35482625 TGAGATCTCAAACTCTGTGCTGG + Intergenic
954513820 3:51152989-51153011 TCAGAGCTCAAACACTGTGCAGG + Intronic
954836466 3:53473432-53473454 TCAGAGCTAAAACACTGTGCTGG + Intergenic
955080528 3:55654237-55654259 TGTGAGGTGATACAGTTTGCTGG - Intronic
955277973 3:57566036-57566058 TGTGACGTGAGCCACTGTGCTGG - Exonic
955432645 3:58864431-58864453 TTTGAGTTGAAACACTGACCAGG + Intronic
955842152 3:63124115-63124137 CGTCAGTTGCAACACTGTGCAGG - Intergenic
956462690 3:69487162-69487184 ACTGGGCTGAAATACTGTGCTGG + Intronic
958257409 3:91340910-91340932 TCAGAGCTTGAACACTGTGCTGG + Intergenic
959290665 3:104469311-104469333 TCAGAGCTCGAACACTGTGCTGG + Intergenic
959763958 3:110001858-110001880 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
960478842 3:118163260-118163282 TCAGAGCTCAAACACTGTGCTGG - Intergenic
961396061 3:126591488-126591510 TGAGATCTCAAACTCTGTGCTGG + Intronic
962297080 3:134200235-134200257 TATGAGCTGTAACACTGCGAAGG + Intronic
964028716 3:152110624-152110646 TGGGCTCTGATACACTGTGCAGG - Intergenic
964270063 3:154945794-154945816 TCAGAGCTCAAACACTGTGCTGG - Intergenic
964332646 3:155620889-155620911 TCAGAGTTCAAACACTGTGCTGG - Intronic
967817153 3:193809280-193809302 TGTGAGCTGACAGGCTGGGCTGG + Intergenic
967984215 3:195083297-195083319 TGTGAGCTGAAACAGTCTTGGGG + Intronic
968752068 4:2395484-2395506 TGGGAGCTGGAACAGTGTGAGGG + Intronic
969164761 4:5298297-5298319 GGAGAGCTCAAGCACTGTGCTGG + Intronic
970182868 4:13417395-13417417 TCAGAGCTCAAACCCTGTGCTGG - Intronic
970430570 4:15985464-15985486 TTTGAACTAAAACACTATGCTGG - Intronic
970791956 4:19868319-19868341 TCAGAGCTCAAACACTGTGCTGG + Intergenic
970891962 4:21056708-21056730 TGTGACCTGAAACCCTCTGAAGG + Intronic
971437289 4:26641056-26641078 TCAGAGCTCAAACACTGTGCTGG - Intronic
971560790 4:28077585-28077607 TCAGAGCTCAAACACCGTGCTGG - Intergenic
972989766 4:44810510-44810532 TTTGGGCTGAAACACAGTGATGG + Intergenic
973732282 4:53833979-53834001 TCAGAGCTCAAACACTGTGCTGG - Intronic
974115211 4:57570910-57570932 TCAGAGCTCAAACACTGTTCTGG + Intergenic
974528486 4:63076854-63076876 TTAGAGCTCAAACACTGTGCTGG + Intergenic
974839637 4:67285979-67286001 TATGAGCTGTAACACTGTGAAGG - Intergenic
975520955 4:75300472-75300494 TCAGAGCTCAAACACTGTGCTGG + Intergenic
975528781 4:75378859-75378881 TAAGAGCTCAAACACTGTGCTGG - Intergenic
975961076 4:79906106-79906128 CGTGAGCAGAAACACCGTGGGGG - Intronic
976506438 4:85852963-85852985 TCAGAGCTCAAACACCGTGCTGG + Intronic
976790299 4:88870776-88870798 TCAGAGCTCAAACACCGTGCTGG - Intronic
976975840 4:91165418-91165440 TTAGAGCTCAAACACTGAGCTGG + Intronic
977124479 4:93147802-93147824 TATGATCTGAAACACTGGGAAGG + Intronic
977416605 4:96742403-96742425 TGTGAGAGGTGACACTGTGCTGG + Intergenic
977561280 4:98536510-98536532 GCAGAGCTCAAACACTGTGCTGG + Intronic
978334747 4:107654405-107654427 CAAGAGCTGAAACACTGTGCCGG + Intronic
978494059 4:109340232-109340254 TTTGAACTCAAACACTGTGCCGG - Intergenic
979162020 4:117473375-117473397 AGTGGGCTGAAATACTGTGCTGG - Intergenic
979191987 4:117872869-117872891 TGTGAGCCTAAACACTGGGGTGG - Intergenic
979272821 4:118782589-118782611 TCAGAGCTCAAACACCGTGCAGG + Intronic
979310557 4:119198292-119198314 TCAGAGCTCAAACACCGTGCTGG - Intronic
979510656 4:121550170-121550192 TCAGAGCTCAAACACTATGCTGG + Intergenic
979512281 4:121567916-121567938 TCAGAGCTCAAACACTGTGCTGG - Intergenic
979516617 4:121616854-121616876 TCAGAGCTCAAACACCGTGCTGG - Intergenic
979757660 4:124361869-124361891 TCAGAACTCAAACACTGTGCTGG - Intergenic
981075510 4:140587426-140587448 GGTGAGCTGACACACTGGGAAGG - Intergenic
981662567 4:147184510-147184532 GCAGAGCTGAAGCACTGTGCTGG - Intergenic
982036739 4:151353328-151353350 TATGAGCTGTAACACTGTGAAGG - Intergenic
983182757 4:164668020-164668042 TCAGATCTGAAACTCTGTGCTGG - Intergenic
983602678 4:169548479-169548501 TCAGAGCTCAAACTCTGTGCTGG + Intronic
985410502 4:189678930-189678952 TATGAGCTGTAACACCGTGAAGG - Intergenic
985475216 5:75100-75122 TGGGAACTGGAACACTGGGCAGG - Intergenic
986005957 5:3669434-3669456 TCAGAGCTCAAACACTGTGCTGG + Intergenic
986126196 5:4884333-4884355 TGTTATCTGAAACACTTGGCTGG - Intergenic
986127053 5:4893061-4893083 TCAGAGCTCAAACACCGTGCTGG + Intergenic
987247055 5:16059774-16059796 TTGCAGCTCAAACACTGTGCAGG + Intergenic
987687641 5:21225886-21225908 TCAGAGCTCAAACACTGTACTGG - Intergenic
988671786 5:33389311-33389333 TCAGAGGTCAAACACTGTGCTGG - Intergenic
989390565 5:40895999-40896021 TCAGAGCTCAAACACTGTGCTGG - Intergenic
990547066 5:56833514-56833536 TGTGAGCTGAGGCACTGTGGGGG - Intronic
990713141 5:58606547-58606569 TCAGAGCTCAAACCCTGTGCTGG - Intronic
991128187 5:63090924-63090946 TCAGAGTTCAAACACTGTGCAGG - Intergenic
991161437 5:63507895-63507917 TCAGAGCTCAAACACTGTGCTGG - Intergenic
991557533 5:67912478-67912500 AGTGAGCTCAAATACTGTGCAGG + Intergenic
992254820 5:74911278-74911300 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
992516742 5:77501531-77501553 TCAGAGCTCAAACGCTGTGCTGG - Intronic
993358240 5:86941328-86941350 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
993497389 5:88622958-88622980 TCAGAGCTCAAACACTGTGCTGG + Intergenic
993578887 5:89635411-89635433 TGAGATCTCAAACTCTGTGCTGG + Intergenic
994545683 5:101163483-101163505 TCGGAGGTCAAACACTGTGCTGG - Intergenic
994586495 5:101715766-101715788 TCAGAGCTCAAACACTGTGCTGG + Intergenic
994861225 5:105198521-105198543 TCAGAGCTCAAACACTGTGCTGG - Intergenic
995179111 5:109213934-109213956 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
995301484 5:110589895-110589917 TTTGAGCTGAAAAACTATGAGGG - Intronic
995459795 5:112390702-112390724 TCAGAGCTCAAACACTGTGCTGG - Intronic
995480427 5:112586937-112586959 TCAGAGCTCAAACACTGTGCTGG - Intergenic
995695798 5:114876847-114876869 TCAGAGCTTGAACACTGTGCTGG - Intergenic
996987444 5:129584408-129584430 GAAGAGCTCAAACACTGTGCTGG + Intronic
997187644 5:131898414-131898436 TCAGAGCTCAAACGCTGTGCTGG + Intronic
999030014 5:148280795-148280817 GCTGAGCTCAAGCACTGTGCTGG + Intronic
1000069014 5:157721572-157721594 TCAGAACTCAAACACTGTGCTGG - Intergenic
1001180052 5:169512113-169512135 AGCAAGCTGAAACCCTGTGCAGG + Intergenic
1002624052 5:180512232-180512254 TGTGAGCAGACCCACTGTGGAGG + Intronic
1002719305 5:181247961-181247983 TGCCAGCTAAAACTCTGTGCAGG + Intronic
1003434366 6:6072211-6072233 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1003496604 6:6668790-6668812 TCAGAGCTCAAACACTGTACCGG - Intergenic
1003987590 6:11452436-11452458 TCTGAGCTCAAACACTGTGCTGG - Intergenic
1004056091 6:12139992-12140014 TCTGAGCTCAAACACCATGCTGG - Intronic
1004587504 6:17016303-17016325 TGTGAGAGGTAACAGTGTGCGGG - Intergenic
1005766464 6:29016148-29016170 TGTGAGGTGTAACACTGTGAGGG + Intergenic
1005918194 6:30373058-30373080 AGTGGGCTGAAATACTGAGCTGG - Intergenic
1005942944 6:30574640-30574662 TGAGAGTTGAAAAATTGTGCAGG - Intronic
1006055085 6:31378197-31378219 TTTGAGCTGAGACAATCTGCTGG - Intergenic
1006278176 6:33022709-33022731 TGTGCTCTGAAAAGCTGTGCGGG + Intergenic
1007312550 6:40958116-40958138 TCTGGGCTGAAGCTCTGTGCTGG - Intergenic
1008014410 6:46502358-46502380 TGTGAGCTGAATCAGTATGTTGG - Intergenic
1010820635 6:80411452-80411474 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1011086543 6:83547097-83547119 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1011150082 6:84262268-84262290 TGTGGTCTGAAACACTGTTAAGG + Intergenic
1011617606 6:89211401-89211423 TGTGAACTGAAAGACTGAGATGG - Intronic
1011884667 6:92078917-92078939 TCTGAGCTCAAACACCATGCTGG - Intergenic
1012778063 6:103522523-103522545 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1012799082 6:103802482-103802504 TGAGATCTCAAACTCTGTGCTGG - Intergenic
1012878477 6:104757219-104757241 TCATAGCTCAAACACTGTGCTGG - Intronic
1013383755 6:109603552-109603574 TGAGATCTGAAACTCTGTGCTGG + Intronic
1013387445 6:109645713-109645735 TCAGAGCTCAAACTCTGTGCTGG - Intronic
1014924607 6:127255690-127255712 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1014938656 6:127413086-127413108 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1015291138 6:131539192-131539214 TCAGAGCATAAACACTGTGCTGG - Intergenic
1016436836 6:144046679-144046701 TCAAAGCTCAAACACTGTGCTGG + Intronic
1016711754 6:147181378-147181400 AGCGGGCTGAAACCCTGTGCTGG + Intergenic
1016917152 6:149254512-149254534 TGTGATCTGAAAGAGTGTTCAGG + Intronic
1017046889 6:150355500-150355522 AGTGGGTTGAAACACTGTTCTGG + Intergenic
1018075995 6:160214234-160214256 TCAGAGCTCAAAAACTGTGCTGG + Intronic
1018794159 6:167172843-167172865 GCTGATCTCAAACACTGTGCTGG - Intronic
1020333468 7:7042763-7042785 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1021370088 7:19833847-19833869 TCTCAGCTGAGACCCTGTGCTGG - Intergenic
1021782254 7:24117838-24117860 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1022541926 7:31145785-31145807 GGTGAGATGCAGCACTGTGCTGG - Intergenic
1024372859 7:48606726-48606748 TCGGAGCTCGAACACTGTGCTGG + Intronic
1024878815 7:54060753-54060775 TGTGTGCTGAGCCACGGTGCTGG + Intergenic
1024923535 7:54587332-54587354 TGTGTGCTGCAACACTGGGAAGG + Intergenic
1025714506 7:63942212-63942234 GCTGAGCTCAAGCACTGTGCTGG - Intergenic
1027574543 7:79915702-79915724 TCTGAGCTCAAACACCGTACTGG - Intergenic
1028004301 7:85542657-85542679 TCTGAGCTGAAACACTGTGCTGG + Intergenic
1028078703 7:86547770-86547792 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1028140006 7:87263335-87263357 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1029006485 7:97215526-97215548 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1029724681 7:102394773-102394795 TGTGTGCTGAAACTCTGTTTTGG - Intronic
1029951925 7:104595551-104595573 TCAGAGCTCAAACACAGTGCTGG + Intronic
1030161242 7:106510493-106510515 TGTGAGCTGACACGAAGTGCAGG + Intergenic
1030534087 7:110744375-110744397 TCAGAGCTCAAACGCTGTGCTGG - Intronic
1030872099 7:114768428-114768450 TGTAAGCTTAGGCACTGTGCTGG + Intergenic
1031808986 7:126342512-126342534 TGTGAGCTGCAACAATGGGATGG + Intergenic
1031927089 7:127649349-127649371 AATGGGCTGAAACACTGTGCAGG + Intergenic
1032786309 7:135203193-135203215 GTTGAACTGAAACACTGAGCAGG - Intronic
1033887571 7:145967209-145967231 TCAGAGCTCAAACACAGTGCTGG - Intergenic
1034040068 7:147868459-147868481 TCAGAGCTCAAACACTGTGCTGG + Intronic
1034077238 7:148243924-148243946 AGTGGGCTAAAATACTGTGCTGG - Intronic
1034394235 7:150808183-150808205 TCAGAGCTCAAACGCTGTGCTGG - Intergenic
1035661373 8:1351069-1351091 TGTGTGTGGAAACACCGTGCGGG + Intergenic
1035661382 8:1351129-1351151 TGTGTGTGGAAACACCGTGCGGG + Intergenic
1035661391 8:1351189-1351211 TGTGTGTGGAAACACCGTGCGGG + Intergenic
1035997117 8:4560557-4560579 TGTGAGCTAAAACACTGTGCTGG + Intronic
1036620678 8:10423000-10423022 TGTCACCAGAAACACTGTGCTGG - Intronic
1036661685 8:10713409-10713431 TGAGAGGGGGAACACTGTGCTGG + Intergenic
1036831493 8:12023547-12023569 TATGAGCTGTAACACCGTGAAGG + Intergenic
1037078998 8:14759654-14759676 TGTGAGCTGAAATACTGTCATGG - Intronic
1037398369 8:18467516-18467538 TCTGAGCTCAAACACTGTGCTGG - Intergenic
1038975894 8:32695659-32695681 TGTTGGCTGGGACACTGTGCCGG + Intronic
1039284619 8:36027001-36027023 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1039814734 8:41083215-41083237 TGTTAGCTTAACCACTGTGCAGG + Intergenic
1040410932 8:47153412-47153434 TCAGAGCTCAAACACCGTGCTGG - Intergenic
1040779958 8:51095598-51095620 TCAGAGCTCAAACGCTGTGCTGG - Intergenic
1040942986 8:52852184-52852206 TCAGAGCTCGAACACTGTGCTGG + Intergenic
1041815718 8:61968537-61968559 TCAGAGCTCAAACACTGTACTGG + Intergenic
1041944376 8:63424815-63424837 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1042622651 8:70723827-70723849 TCAGAGCTTAAACAATGTGCTGG + Intronic
1042645243 8:70979747-70979769 TCAGAGCTCAAACATTGTGCTGG + Intergenic
1044314547 8:90734289-90734311 TCAGAGCTCAAACGCTGTGCTGG + Intronic
1044546619 8:93466968-93466990 TCAGATCTCAAACACTGTGCTGG - Intergenic
1044576927 8:93779863-93779885 TCTGAGCTCAAACGCTGTGCTGG + Intronic
1045123446 8:99063725-99063747 TCTGAGCTCAAACACCATGCTGG - Intronic
1045618963 8:103952237-103952259 TCGGAGCTCAAACACTGTGCTGG - Intronic
1045779397 8:105846142-105846164 TCAGAGCTCGAACACTGTGCTGG + Intergenic
1046607948 8:116391358-116391380 TCAGAACTCAAACACTGTGCAGG - Intergenic
1046939430 8:119916631-119916653 AATGGGCTGAAATACTGTGCAGG - Intronic
1048266573 8:132992536-132992558 AGTGCTATGAAACACTGTGCAGG - Intronic
1048521218 8:135157126-135157148 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1050583668 9:7087137-7087159 TGTCAGCTGATACACAGTGATGG + Intergenic
1050852116 9:10300893-10300915 TCAGAGCTCGAACACTGTGCTGG - Intronic
1051100112 9:13511900-13511922 TGTAAGATGAAACACACTGCGGG - Intergenic
1051814372 9:21087841-21087863 TCAGAGCTCAAGCACTGTGCTGG - Intergenic
1051928896 9:22362669-22362691 TATGAGCTGTAACACCGTGAAGG - Intergenic
1052063809 9:23992326-23992348 TCAGAACTCAAACACTGTGCTGG - Intergenic
1054890032 9:70240933-70240955 TCAGAGCTCAGACACTGTGCTGG - Intergenic
1055053173 9:71999985-72000007 TCCGAGCTCAAACACTGTGCTGG + Intergenic
1055617127 9:78084234-78084256 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1056012935 9:82351621-82351643 TGTGAGCTGAAAAAGTCTTCAGG - Intergenic
1056787202 9:89601950-89601972 TGTGACCTGAAGCACAGAGCAGG + Intergenic
1056997101 9:91473195-91473217 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
1057056731 9:91967812-91967834 TGTGGCCTGAAACAGTGTGTGGG + Intergenic
1057250625 9:93498404-93498426 AGAGAGCTGAAACCCTGGGCAGG + Intronic
1057305686 9:93910802-93910824 GGTGAAATGAAACACTGCGCAGG + Intergenic
1057698103 9:97341669-97341691 TCGGAGCTCAAACACTGTGCTGG + Intronic
1057826351 9:98375180-98375202 TGTGAGGGGAAAGACTGAGCAGG - Intronic
1059056797 9:110991527-110991549 TGTGAGCTGAAACACTATTTTGG + Intronic
1059476408 9:114551288-114551310 TGGGAGCTGGAAAACTGTCCCGG + Intergenic
1059984469 9:119808685-119808707 TGTGAGATGTAAAACTGTGATGG - Intergenic
1060133912 9:121133129-121133151 TCTGAGCTCAAACACTGTGCTGG + Intronic
1061595219 9:131624579-131624601 TCTGAGCTCAGACACTGGGCAGG - Intronic
1203661074 Un_KI270753v1:43270-43292 TATGAGCTGTAACACTGTGAAGG + Intergenic
1203672260 Un_KI270755v1:26495-26517 TATGAGCTGTAACACCGTGAAGG + Intergenic
1185817068 X:3165886-3165908 TGTGGGTTGAAACACTGTTTTGG - Intergenic
1187705378 X:22004943-22004965 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1187829127 X:23363139-23363161 TCAGAGCTCAAACACTGTGCTGG + Intronic
1188084184 X:25882966-25882988 TCAGAGCTCAAATACTGTGCTGG - Intergenic
1188108947 X:26175105-26175127 TCAGAGCTCAAACACCGTGCTGG - Intergenic
1188166820 X:26873131-26873153 TATGAGCTGTAACACTGCGAAGG - Intergenic
1188215486 X:27471466-27471488 AGTGAGCTGGAACAAAGTGCGGG - Intergenic
1188944203 X:36278078-36278100 TCAGAGCTCAAACACCGTGCTGG + Intronic
1188978586 X:36705667-36705689 TCAGATCTCAAACACTGTGCTGG + Intergenic
1189702555 X:43727183-43727205 TCAGAGCTCAAACACTGTGCTGG + Intronic
1191012400 X:55774393-55774415 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1191645697 X:63478646-63478668 TCAGAGCTCAAACGCTGTGCTGG - Intergenic
1191947808 X:66554421-66554443 TTGGAGCTCAAAGACTGTGCTGG - Intergenic
1192124634 X:68490678-68490700 TGTGAGATAAAACACAGTGTAGG - Intergenic
1192169990 X:68848232-68848254 TGTGAGCAGAAGCGCTGTGAGGG - Intergenic
1192395931 X:70780961-70780983 TCCGAGCTCAAACACTGTGCTGG - Intronic
1192406457 X:70890860-70890882 TCTGAGCTCAAACACTGTGCTGG - Intronic
1192612956 X:72586077-72586099 TCAGAGCTCAAACACTGTGCTGG - Intronic
1192857245 X:75025294-75025316 TCAGATCTGAAACTCTGTGCTGG + Intergenic
1192964233 X:76159945-76159967 TCAGAGCTCGAACACTGTGCTGG - Intergenic
1192973743 X:76261034-76261056 TCAGAGCTCAAACGCTGTGCTGG + Intergenic
1192977601 X:76302928-76302950 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1193073881 X:77334587-77334609 TCAGAGCTGAAACACTGTGTTGG - Intergenic
1193343730 X:80382473-80382495 TCAGAGCTCAAACACTGTGCTGG + Intronic
1193402643 X:81064290-81064312 TCTGAGCTTAAACACCATGCTGG - Intergenic
1193409381 X:81144127-81144149 TCAGAGCTCAAACACTGTTCTGG - Intronic
1193661817 X:84267375-84267397 TCAGAGCTCAAACACCGTGCTGG + Intergenic
1194066607 X:89269362-89269384 TATGAGCTGTAACACCGTGAAGG - Intergenic
1194726963 X:97410027-97410049 TCAGAGCTCAAACACTGTGCTGG - Intronic
1195262990 X:103152296-103152318 GCTGAGCTGAGGCACTGTGCAGG + Intergenic
1195414283 X:104602955-104602977 TCAGAGCTTGAACACTGTGCTGG - Intronic
1195810572 X:108824725-108824747 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1195817497 X:108904300-108904322 TCAGATCTCAAACACTGTGCTGG - Intergenic
1196139560 X:112246207-112246229 TCAGAGCTCAAACACTGTGCTGG + Intergenic
1196583097 X:117398042-117398064 TGTGAGCTGAATCATTGTGAAGG - Intergenic
1198293659 X:135263305-135263327 TCAGAGCTCAAACACTGTGCTGG + Intronic
1198595516 X:138231359-138231381 TCAGAGCTCAAACACTGTGCTGG - Intergenic
1199449945 X:147968055-147968077 TCAGAGCTCAAACACCGTGCTGG - Intergenic
1199911799 X:152295186-152295208 TCCGAGCTCAAACACTGTGCTGG + Intronic
1200405887 Y:2811128-2811150 TCAGAGCTCAAACACTATGCTGG + Intergenic
1201264265 Y:12191011-12191033 TGTGGGTTGAAACACTGTTTTGG + Intergenic
1201271599 Y:12261095-12261117 TGTGAGCTGAAACACTGTGAGGG - Intergenic
1201314404 Y:12629586-12629608 TCTGAGCTCAAACACTGTGCTGG + Intergenic
1201333450 Y:12853025-12853047 TCAGAGCTCAAACACTGTGTTGG + Intronic
1201543246 Y:15132140-15132162 TCAGAGCTCCAACACTGTGCTGG - Intergenic
1201670585 Y:16515934-16515956 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1201957769 Y:19645213-19645235 TCAGAGCTCAAACACAGTGCTGG + Intergenic