ID: 1108266977

View in Genome Browser
Species Human (GRCh38)
Location 13:48720658-48720680
Sequence TGTGAGCTAAAACACTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108266977_1108266980 -1 Left 1108266977 13:48720658-48720680 CCAGAACAGTGTTTTAGCTCACA No data
Right 1108266980 13:48720680-48720702 AGTTTACACATGGATTGTGGAGG No data
1108266977_1108266979 -4 Left 1108266977 13:48720658-48720680 CCAGAACAGTGTTTTAGCTCACA No data
Right 1108266979 13:48720677-48720699 CACAGTTTACACATGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108266977 Original CRISPR TGTGAGCTAAAACACTGTTC TGG (reversed) Intergenic
No off target data available for this crispr