ID: 1108270943

View in Genome Browser
Species Human (GRCh38)
Location 13:48759017-48759039
Sequence CCATCTCTTGCATCTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108270943_1108270949 6 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270949 13:48759046-48759068 AGTTTCTCCACCAGGGCCTCTGG No data
1108270943_1108270947 -2 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270947 13:48759038-48759060 GGAAGGAAAGTTTCTCCACCAGG No data
1108270943_1108270952 17 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270952 13:48759057-48759079 CAGGGCCTCTGGAGAGAGTGTGG No data
1108270943_1108270948 -1 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270948 13:48759039-48759061 GAAGGAAAGTTTCTCCACCAGGG No data
1108270943_1108270954 25 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270954 13:48759065-48759087 CTGGAGAGAGTGTGGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108270943 Original CRISPR CCATCTCTTGCATCTTTTGG AGG (reversed) Intergenic
No off target data available for this crispr