ID: 1108270947

View in Genome Browser
Species Human (GRCh38)
Location 13:48759038-48759060
Sequence GGAAGGAAAGTTTCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108270941_1108270947 15 Left 1108270941 13:48759000-48759022 CCATGGAACGCCTGCAGCCTCCA No data
Right 1108270947 13:48759038-48759060 GGAAGGAAAGTTTCTCCACCAGG No data
1108270939_1108270947 22 Left 1108270939 13:48758993-48759015 CCATGTCCCATGGAACGCCTGCA No data
Right 1108270947 13:48759038-48759060 GGAAGGAAAGTTTCTCCACCAGG No data
1108270943_1108270947 -2 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270947 13:48759038-48759060 GGAAGGAAAGTTTCTCCACCAGG No data
1108270942_1108270947 5 Left 1108270942 13:48759010-48759032 CCTGCAGCCTCCAAAAGATGCAA No data
Right 1108270947 13:48759038-48759060 GGAAGGAAAGTTTCTCCACCAGG No data
1108270945_1108270947 -5 Left 1108270945 13:48759020-48759042 CCAAAAGATGCAAGAGATGGAAG No data
Right 1108270947 13:48759038-48759060 GGAAGGAAAGTTTCTCCACCAGG No data
1108270940_1108270947 16 Left 1108270940 13:48758999-48759021 CCCATGGAACGCCTGCAGCCTCC No data
Right 1108270947 13:48759038-48759060 GGAAGGAAAGTTTCTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108270947 Original CRISPR GGAAGGAAAGTTTCTCCACC AGG Intergenic
No off target data available for this crispr