ID: 1108270948

View in Genome Browser
Species Human (GRCh38)
Location 13:48759039-48759061
Sequence GAAGGAAAGTTTCTCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108270943_1108270948 -1 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270948 13:48759039-48759061 GAAGGAAAGTTTCTCCACCAGGG No data
1108270939_1108270948 23 Left 1108270939 13:48758993-48759015 CCATGTCCCATGGAACGCCTGCA No data
Right 1108270948 13:48759039-48759061 GAAGGAAAGTTTCTCCACCAGGG No data
1108270945_1108270948 -4 Left 1108270945 13:48759020-48759042 CCAAAAGATGCAAGAGATGGAAG No data
Right 1108270948 13:48759039-48759061 GAAGGAAAGTTTCTCCACCAGGG No data
1108270942_1108270948 6 Left 1108270942 13:48759010-48759032 CCTGCAGCCTCCAAAAGATGCAA No data
Right 1108270948 13:48759039-48759061 GAAGGAAAGTTTCTCCACCAGGG No data
1108270940_1108270948 17 Left 1108270940 13:48758999-48759021 CCCATGGAACGCCTGCAGCCTCC No data
Right 1108270948 13:48759039-48759061 GAAGGAAAGTTTCTCCACCAGGG No data
1108270941_1108270948 16 Left 1108270941 13:48759000-48759022 CCATGGAACGCCTGCAGCCTCCA No data
Right 1108270948 13:48759039-48759061 GAAGGAAAGTTTCTCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108270948 Original CRISPR GAAGGAAAGTTTCTCCACCA GGG Intergenic
No off target data available for this crispr