ID: 1108270954

View in Genome Browser
Species Human (GRCh38)
Location 13:48759065-48759087
Sequence CTGGAGAGAGTGTGGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108270943_1108270954 25 Left 1108270943 13:48759017-48759039 CCTCCAAAAGATGCAAGAGATGG No data
Right 1108270954 13:48759065-48759087 CTGGAGAGAGTGTGGCCTGAAGG No data
1108270945_1108270954 22 Left 1108270945 13:48759020-48759042 CCAAAAGATGCAAGAGATGGAAG No data
Right 1108270954 13:48759065-48759087 CTGGAGAGAGTGTGGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108270954 Original CRISPR CTGGAGAGAGTGTGGCCTGA AGG Intergenic
No off target data available for this crispr