ID: 1108272042

View in Genome Browser
Species Human (GRCh38)
Location 13:48771184-48771206
Sequence AGAGGAATTCCTCAGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272042_1108272047 29 Left 1108272042 13:48771184-48771206 CCAGGAGGCTGAGGAATTCCTCT No data
Right 1108272047 13:48771236-48771258 CTGAATCAGCTCTTGCGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1108272042_1108272046 28 Left 1108272042 13:48771184-48771206 CCAGGAGGCTGAGGAATTCCTCT No data
Right 1108272046 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272042 Original CRISPR AGAGGAATTCCTCAGCCTCC TGG (reversed) Intergenic