ID: 1108272043

View in Genome Browser
Species Human (GRCh38)
Location 13:48771202-48771224
Sequence TCTGTGGCAAGAATCTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272043_1108272048 25 Left 1108272043 13:48771202-48771224 CCTCTACAGATTCTTGCCACAGA No data
Right 1108272048 13:48771250-48771272 GCGAGAGGGCTCCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 90
1108272043_1108272046 10 Left 1108272043 13:48771202-48771224 CCTCTACAGATTCTTGCCACAGA No data
Right 1108272046 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1108272043_1108272047 11 Left 1108272043 13:48771202-48771224 CCTCTACAGATTCTTGCCACAGA No data
Right 1108272047 13:48771236-48771258 CTGAATCAGCTCTTGCGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272043 Original CRISPR TCTGTGGCAAGAATCTGTAG AGG (reversed) Intergenic