ID: 1108272044

View in Genome Browser
Species Human (GRCh38)
Location 13:48771218-48771240
Sequence TTCAGGTATGTGATTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 322}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272044_1108272048 9 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272048 13:48771250-48771272 GCGAGAGGGCTCCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 90
1108272044_1108272052 30 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272052 13:48771271-48771293 GGCTGACCTGACTTCCCTCCGGG No data
1108272044_1108272047 -5 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272047 13:48771236-48771258 CTGAATCAGCTCTTGCGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1108272044_1108272051 29 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272051 13:48771270-48771292 TGGCTGACCTGACTTCCCTCCGG No data
1108272044_1108272046 -6 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272046 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272044 Original CRISPR TTCAGGTATGTGATTTTCTG TGG (reversed) Intergenic