ID: 1108272045

View in Genome Browser
Species Human (GRCh38)
Location 13:48771235-48771257
Sequence CCTCTCGCAAGAGCTGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272045_1108272048 -8 Left 1108272045 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1108272048 13:48771250-48771272 GCGAGAGGGCTCCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 90
1108272045_1108272052 13 Left 1108272045 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1108272052 13:48771271-48771293 GGCTGACCTGACTTCCCTCCGGG No data
1108272045_1108272051 12 Left 1108272045 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1108272051 13:48771270-48771292 TGGCTGACCTGACTTCCCTCCGG No data
1108272045_1108272054 22 Left 1108272045 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1108272054 13:48771280-48771302 GACTTCCCTCCGGGCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272045 Original CRISPR CCTCTCGCAAGAGCTGATTC AGG (reversed) Intergenic