ID: 1108272046

View in Genome Browser
Species Human (GRCh38)
Location 13:48771235-48771257
Sequence CCTGAATCAGCTCTTGCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272042_1108272046 28 Left 1108272042 13:48771184-48771206 CCAGGAGGCTGAGGAATTCCTCT No data
Right 1108272046 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1108272043_1108272046 10 Left 1108272043 13:48771202-48771224 CCTCTACAGATTCTTGCCACAGA No data
Right 1108272046 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1108272044_1108272046 -6 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272046 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272046 Original CRISPR CCTGAATCAGCTCTTGCGAG AGG Intergenic