ID: 1108272048

View in Genome Browser
Species Human (GRCh38)
Location 13:48771250-48771272
Sequence GCGAGAGGGCTCCCTCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272043_1108272048 25 Left 1108272043 13:48771202-48771224 CCTCTACAGATTCTTGCCACAGA No data
Right 1108272048 13:48771250-48771272 GCGAGAGGGCTCCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 90
1108272045_1108272048 -8 Left 1108272045 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1108272048 13:48771250-48771272 GCGAGAGGGCTCCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 90
1108272044_1108272048 9 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272048 13:48771250-48771272 GCGAGAGGGCTCCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272048 Original CRISPR GCGAGAGGGCTCCCTCAGTG TGG Intergenic