ID: 1108272049

View in Genome Browser
Species Human (GRCh38)
Location 13:48771261-48771283
Sequence AGTCAGGTCAGCCACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272049_1108272054 -4 Left 1108272049 13:48771261-48771283 CCCTCAGTGTGGCTGACCTGACT 0: 1
1: 1
2: 2
3: 13
4: 141
Right 1108272054 13:48771280-48771302 GACTTCCCTCCGGGCCCCACTGG No data
1108272049_1108272064 26 Left 1108272049 13:48771261-48771283 CCCTCAGTGTGGCTGACCTGACT 0: 1
1: 1
2: 2
3: 13
4: 141
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272049 Original CRISPR AGTCAGGTCAGCCACACTGA GGG (reversed) Intergenic