ID: 1108272050

View in Genome Browser
Species Human (GRCh38)
Location 13:48771262-48771284
Sequence AAGTCAGGTCAGCCACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 2, 2: 2, 3: 12, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272050_1108272054 -5 Left 1108272050 13:48771262-48771284 CCTCAGTGTGGCTGACCTGACTT 0: 1
1: 2
2: 2
3: 12
4: 144
Right 1108272054 13:48771280-48771302 GACTTCCCTCCGGGCCCCACTGG No data
1108272050_1108272064 25 Left 1108272050 13:48771262-48771284 CCTCAGTGTGGCTGACCTGACTT 0: 1
1: 2
2: 2
3: 12
4: 144
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272050 Original CRISPR AAGTCAGGTCAGCCACACTG AGG (reversed) Intergenic