ID: 1108272052

View in Genome Browser
Species Human (GRCh38)
Location 13:48771271-48771293
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272044_1108272052 30 Left 1108272044 13:48771218-48771240 CCACAGAAAATCACATACCTGAA 0: 1
1: 1
2: 6
3: 31
4: 322
Right 1108272052 13:48771271-48771293 GGCTGACCTGACTTCCCTCCGGG No data
1108272045_1108272052 13 Left 1108272045 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1108272052 13:48771271-48771293 GGCTGACCTGACTTCCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272052 Original CRISPR GGCTGACCTGACTTCCCTCC GGG Intergenic