ID: 1108272054

View in Genome Browser
Species Human (GRCh38)
Location 13:48771280-48771302
Sequence GACTTCCCTCCGGGCCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272050_1108272054 -5 Left 1108272050 13:48771262-48771284 CCTCAGTGTGGCTGACCTGACTT 0: 1
1: 2
2: 2
3: 12
4: 144
Right 1108272054 13:48771280-48771302 GACTTCCCTCCGGGCCCCACTGG No data
1108272045_1108272054 22 Left 1108272045 13:48771235-48771257 CCTGAATCAGCTCTTGCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1108272054 13:48771280-48771302 GACTTCCCTCCGGGCCCCACTGG No data
1108272049_1108272054 -4 Left 1108272049 13:48771261-48771283 CCCTCAGTGTGGCTGACCTGACT 0: 1
1: 1
2: 2
3: 13
4: 141
Right 1108272054 13:48771280-48771302 GACTTCCCTCCGGGCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272054 Original CRISPR GACTTCCCTCCGGGCCCCAC TGG Intergenic