ID: 1108272056

View in Genome Browser
Species Human (GRCh38)
Location 13:48771286-48771308
Sequence GGATGTCCAGTGGGGCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272056_1108272064 1 Left 1108272056 13:48771286-48771308 CCTCCGGGCCCCACTGGACATCC No data
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272056_1108272073 28 Left 1108272056 13:48771286-48771308 CCTCCGGGCCCCACTGGACATCC No data
Right 1108272073 13:48771337-48771359 TGAGATGGAAACAGATAAGTAGG 0: 1
1: 2
2: 3
3: 34
4: 301
1108272056_1108272069 13 Left 1108272056 13:48771286-48771308 CCTCCGGGCCCCACTGGACATCC No data
Right 1108272069 13:48771322-48771344 TCCACCCAAGGATGATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272056 Original CRISPR GGATGTCCAGTGGGGCCCGG AGG (reversed) Intergenic