ID: 1108272057 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:48771289-48771311 |
| Sequence | TGGGGATGTCCAGTGGGGCC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108272057_1108272064 | -2 | Left | 1108272057 | 13:48771289-48771311 | CCGGGCCCCACTGGACATCCCCA | No data | ||
| Right | 1108272064 | 13:48771310-48771332 | CAACCCAGACCCTCCACCCAAGG | 0: 1 1: 3 2: 7 3: 52 4: 428 |
||||
| 1108272057_1108272073 | 25 | Left | 1108272057 | 13:48771289-48771311 | CCGGGCCCCACTGGACATCCCCA | No data | ||
| Right | 1108272073 | 13:48771337-48771359 | TGAGATGGAAACAGATAAGTAGG | 0: 1 1: 2 2: 3 3: 34 4: 301 |
||||
| 1108272057_1108272069 | 10 | Left | 1108272057 | 13:48771289-48771311 | CCGGGCCCCACTGGACATCCCCA | No data | ||
| Right | 1108272069 | 13:48771322-48771344 | TCCACCCAAGGATGATGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108272057 | Original CRISPR | TGGGGATGTCCAGTGGGGCC CGG (reversed) | Intergenic | ||