ID: 1108272059

View in Genome Browser
Species Human (GRCh38)
Location 13:48771295-48771317
Sequence CTGGGTTGGGGATGTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 2, 2: 1, 3: 17, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272059_1108272073 19 Left 1108272059 13:48771295-48771317 CCCACTGGACATCCCCAACCCAG 0: 1
1: 2
2: 1
3: 17
4: 250
Right 1108272073 13:48771337-48771359 TGAGATGGAAACAGATAAGTAGG 0: 1
1: 2
2: 3
3: 34
4: 301
1108272059_1108272069 4 Left 1108272059 13:48771295-48771317 CCCACTGGACATCCCCAACCCAG 0: 1
1: 2
2: 1
3: 17
4: 250
Right 1108272069 13:48771322-48771344 TCCACCCAAGGATGATGAGATGG No data
1108272059_1108272064 -8 Left 1108272059 13:48771295-48771317 CCCACTGGACATCCCCAACCCAG 0: 1
1: 2
2: 1
3: 17
4: 250
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272059 Original CRISPR CTGGGTTGGGGATGTCCAGT GGG (reversed) Intergenic