ID: 1108272060

View in Genome Browser
Species Human (GRCh38)
Location 13:48771296-48771318
Sequence TCTGGGTTGGGGATGTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 2, 2: 1, 3: 20, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272060_1108272064 -9 Left 1108272060 13:48771296-48771318 CCACTGGACATCCCCAACCCAGA 0: 1
1: 2
2: 1
3: 20
4: 208
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272060_1108272073 18 Left 1108272060 13:48771296-48771318 CCACTGGACATCCCCAACCCAGA 0: 1
1: 2
2: 1
3: 20
4: 208
Right 1108272073 13:48771337-48771359 TGAGATGGAAACAGATAAGTAGG 0: 1
1: 2
2: 3
3: 34
4: 301
1108272060_1108272069 3 Left 1108272060 13:48771296-48771318 CCACTGGACATCCCCAACCCAGA 0: 1
1: 2
2: 1
3: 20
4: 208
Right 1108272069 13:48771322-48771344 TCCACCCAAGGATGATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272060 Original CRISPR TCTGGGTTGGGGATGTCCAG TGG (reversed) Intergenic