ID: 1108272060 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:48771296-48771318 |
| Sequence | TCTGGGTTGGGGATGTCCAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 232 | |||
| Summary | {0: 1, 1: 2, 2: 1, 3: 20, 4: 208} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108272060_1108272064 | -9 | Left | 1108272060 | 13:48771296-48771318 | CCACTGGACATCCCCAACCCAGA | 0: 1 1: 2 2: 1 3: 20 4: 208 |
||
| Right | 1108272064 | 13:48771310-48771332 | CAACCCAGACCCTCCACCCAAGG | 0: 1 1: 3 2: 7 3: 52 4: 428 |
||||
| 1108272060_1108272073 | 18 | Left | 1108272060 | 13:48771296-48771318 | CCACTGGACATCCCCAACCCAGA | 0: 1 1: 2 2: 1 3: 20 4: 208 |
||
| Right | 1108272073 | 13:48771337-48771359 | TGAGATGGAAACAGATAAGTAGG | 0: 1 1: 2 2: 3 3: 34 4: 301 |
||||
| 1108272060_1108272069 | 3 | Left | 1108272060 | 13:48771296-48771318 | CCACTGGACATCCCCAACCCAGA | 0: 1 1: 2 2: 1 3: 20 4: 208 |
||
| Right | 1108272069 | 13:48771322-48771344 | TCCACCCAAGGATGATGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108272060 | Original CRISPR | TCTGGGTTGGGGATGTCCAG TGG (reversed) | Intergenic | ||