ID: 1108272061 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:48771307-48771329 |
Sequence | TGGGTGGAGGGTCTGGGTTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 833 | |||
Summary | {0: 1, 1: 3, 2: 5, 3: 124, 4: 700} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1108272061_1108272073 | 7 | Left | 1108272061 | 13:48771307-48771329 | CCCCAACCCAGACCCTCCACCCA | 0: 1 1: 3 2: 5 3: 124 4: 700 |
||
Right | 1108272073 | 13:48771337-48771359 | TGAGATGGAAACAGATAAGTAGG | 0: 1 1: 2 2: 3 3: 34 4: 301 |
||||
1108272061_1108272069 | -8 | Left | 1108272061 | 13:48771307-48771329 | CCCCAACCCAGACCCTCCACCCA | 0: 1 1: 3 2: 5 3: 124 4: 700 |
||
Right | 1108272069 | 13:48771322-48771344 | TCCACCCAAGGATGATGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1108272061 | Original CRISPR | TGGGTGGAGGGTCTGGGTTG GGG (reversed) | Intergenic | ||