ID: 1108272064

View in Genome Browser
Species Human (GRCh38)
Location 13:48771310-48771332
Sequence CAACCCAGACCCTCCACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 3, 2: 7, 3: 52, 4: 428}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108272058_1108272064 -7 Left 1108272058 13:48771294-48771316 CCCCACTGGACATCCCCAACCCA 0: 1
1: 2
2: 2
3: 17
4: 238
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272060_1108272064 -9 Left 1108272060 13:48771296-48771318 CCACTGGACATCCCCAACCCAGA 0: 1
1: 2
2: 1
3: 20
4: 208
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272053_1108272064 10 Left 1108272053 13:48771277-48771299 CCTGACTTCCCTCCGGGCCCCAC No data
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272049_1108272064 26 Left 1108272049 13:48771261-48771283 CCCTCAGTGTGGCTGACCTGACT 0: 1
1: 1
2: 2
3: 13
4: 141
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272059_1108272064 -8 Left 1108272059 13:48771295-48771317 CCCACTGGACATCCCCAACCCAG 0: 1
1: 2
2: 1
3: 17
4: 250
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272055_1108272064 2 Left 1108272055 13:48771285-48771307 CCCTCCGGGCCCCACTGGACATC No data
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272050_1108272064 25 Left 1108272050 13:48771262-48771284 CCTCAGTGTGGCTGACCTGACTT 0: 1
1: 2
2: 2
3: 12
4: 144
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272056_1108272064 1 Left 1108272056 13:48771286-48771308 CCTCCGGGCCCCACTGGACATCC No data
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428
1108272057_1108272064 -2 Left 1108272057 13:48771289-48771311 CCGGGCCCCACTGGACATCCCCA No data
Right 1108272064 13:48771310-48771332 CAACCCAGACCCTCCACCCAAGG 0: 1
1: 3
2: 7
3: 52
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108272064 Original CRISPR CAACCCAGACCCTCCACCCA AGG Intergenic