ID: 1108272068 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:48771320-48771342 |
Sequence | ATCTCATCATCCTTGGGTGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1108272068_1108272073 | -6 | Left | 1108272068 | 13:48771320-48771342 | CCTCCACCCAAGGATGATGAGAT | No data | ||
Right | 1108272073 | 13:48771337-48771359 | TGAGATGGAAACAGATAAGTAGG | 0: 1 1: 2 2: 3 3: 34 4: 301 |
||||
1108272068_1108272074 | 19 | Left | 1108272068 | 13:48771320-48771342 | CCTCCACCCAAGGATGATGAGAT | No data | ||
Right | 1108272074 | 13:48771362-48771384 | AAGAAAGAAGTCCCTAAGTGTGG | 0: 1 1: 1 2: 3 3: 22 4: 233 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1108272068 | Original CRISPR | ATCTCATCATCCTTGGGTGG AGG (reversed) | Intergenic | ||