ID: 1108273299

View in Genome Browser
Species Human (GRCh38)
Location 13:48783858-48783880
Sequence AAATATCCACAAAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108273296_1108273299 -8 Left 1108273296 13:48783843-48783865 CCTCTGTTCCACAAAAAATATCC No data
Right 1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG No data
1108273293_1108273299 27 Left 1108273293 13:48783808-48783830 CCGCTAGGGTAATGTTCCAGGGA 0: 2
1: 5
2: 28
3: 40
4: 128
Right 1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG No data
1108273295_1108273299 11 Left 1108273295 13:48783824-48783846 CCAGGGAGGAGCGCAGCTGCCTC No data
Right 1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108273299 Original CRISPR AAATATCCACAAAAGGAGCA AGG Intergenic
No off target data available for this crispr