ID: 1108276713

View in Genome Browser
Species Human (GRCh38)
Location 13:48818419-48818441
Sequence TGAAGTTACCACCTTAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108276710_1108276713 7 Left 1108276710 13:48818389-48818411 CCTATCTTATATTTCATATCTTA No data
Right 1108276713 13:48818419-48818441 TGAAGTTACCACCTTAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108276713 Original CRISPR TGAAGTTACCACCTTAATGG TGG Intergenic
No off target data available for this crispr