ID: 1108282036

View in Genome Browser
Species Human (GRCh38)
Location 13:48870454-48870476
Sequence CTCACCTGGCAGCCACTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108282036_1108282038 0 Left 1108282036 13:48870454-48870476 CCTGGGAGTGGCTGCCAGGTGAG No data
Right 1108282038 13:48870477-48870499 ATGAACAGTCTGATTTCCAGTGG No data
1108282036_1108282042 16 Left 1108282036 13:48870454-48870476 CCTGGGAGTGGCTGCCAGGTGAG No data
Right 1108282042 13:48870493-48870515 CCAGTGGGGTGCCACACAGATGG No data
1108282036_1108282039 1 Left 1108282036 13:48870454-48870476 CCTGGGAGTGGCTGCCAGGTGAG No data
Right 1108282039 13:48870478-48870500 TGAACAGTCTGATTTCCAGTGGG No data
1108282036_1108282040 2 Left 1108282036 13:48870454-48870476 CCTGGGAGTGGCTGCCAGGTGAG No data
Right 1108282040 13:48870479-48870501 GAACAGTCTGATTTCCAGTGGGG No data
1108282036_1108282043 17 Left 1108282036 13:48870454-48870476 CCTGGGAGTGGCTGCCAGGTGAG No data
Right 1108282043 13:48870494-48870516 CAGTGGGGTGCCACACAGATGGG No data
1108282036_1108282044 23 Left 1108282036 13:48870454-48870476 CCTGGGAGTGGCTGCCAGGTGAG No data
Right 1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108282036 Original CRISPR CTCACCTGGCAGCCACTCCC AGG (reversed) Intergenic
No off target data available for this crispr