ID: 1108282037

View in Genome Browser
Species Human (GRCh38)
Location 13:48870468-48870490
Sequence ATCAGACTGTTCATCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108282037_1108282046 18 Left 1108282037 13:48870468-48870490 CCAGGTGAGATGAACAGTCTGAT No data
Right 1108282046 13:48870509-48870531 CAGATGGGACATGGCTTAAGAGG No data
1108282037_1108282048 27 Left 1108282037 13:48870468-48870490 CCAGGTGAGATGAACAGTCTGAT No data
Right 1108282048 13:48870518-48870540 CATGGCTTAAGAGGAATCCTGGG No data
1108282037_1108282042 2 Left 1108282037 13:48870468-48870490 CCAGGTGAGATGAACAGTCTGAT No data
Right 1108282042 13:48870493-48870515 CCAGTGGGGTGCCACACAGATGG No data
1108282037_1108282043 3 Left 1108282037 13:48870468-48870490 CCAGGTGAGATGAACAGTCTGAT No data
Right 1108282043 13:48870494-48870516 CAGTGGGGTGCCACACAGATGGG No data
1108282037_1108282044 9 Left 1108282037 13:48870468-48870490 CCAGGTGAGATGAACAGTCTGAT No data
Right 1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG No data
1108282037_1108282047 26 Left 1108282037 13:48870468-48870490 CCAGGTGAGATGAACAGTCTGAT No data
Right 1108282047 13:48870517-48870539 ACATGGCTTAAGAGGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108282037 Original CRISPR ATCAGACTGTTCATCTCACC TGG (reversed) Intergenic
No off target data available for this crispr