ID: 1108282044

View in Genome Browser
Species Human (GRCh38)
Location 13:48870500-48870522
Sequence GGTGCCACACAGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108282037_1108282044 9 Left 1108282037 13:48870468-48870490 CCAGGTGAGATGAACAGTCTGAT No data
Right 1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG No data
1108282035_1108282044 24 Left 1108282035 13:48870453-48870475 CCCTGGGAGTGGCTGCCAGGTGA No data
Right 1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG No data
1108282036_1108282044 23 Left 1108282036 13:48870454-48870476 CCTGGGAGTGGCTGCCAGGTGAG No data
Right 1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108282044 Original CRISPR GGTGCCACACAGATGGGACA TGG Intergenic
No off target data available for this crispr