ID: 1108282532

View in Genome Browser
Species Human (GRCh38)
Location 13:48874304-48874326
Sequence CTCTGGGTGTGGAGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108282532_1108282542 23 Left 1108282532 13:48874304-48874326 CCCTTTATCCTCCACACCCAGAG No data
Right 1108282542 13:48874350-48874372 GGGAAGACAGAGACCAGAAAAGG No data
1108282532_1108282543 24 Left 1108282532 13:48874304-48874326 CCCTTTATCCTCCACACCCAGAG No data
Right 1108282543 13:48874351-48874373 GGAAGACAGAGACCAGAAAAGGG No data
1108282532_1108282538 -4 Left 1108282532 13:48874304-48874326 CCCTTTATCCTCCACACCCAGAG No data
Right 1108282538 13:48874323-48874345 AGAGCTGATGACACTGAGTGAGG No data
1108282532_1108282539 1 Left 1108282532 13:48874304-48874326 CCCTTTATCCTCCACACCCAGAG No data
Right 1108282539 13:48874328-48874350 TGATGACACTGAGTGAGGCGAGG No data
1108282532_1108282540 2 Left 1108282532 13:48874304-48874326 CCCTTTATCCTCCACACCCAGAG No data
Right 1108282540 13:48874329-48874351 GATGACACTGAGTGAGGCGAGGG No data
1108282532_1108282541 3 Left 1108282532 13:48874304-48874326 CCCTTTATCCTCCACACCCAGAG No data
Right 1108282541 13:48874330-48874352 ATGACACTGAGTGAGGCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108282532 Original CRISPR CTCTGGGTGTGGAGGATAAA GGG (reversed) Intergenic
No off target data available for this crispr